GenePrediction:GLEAN_8127 Details

Name: GLEAN_8127
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:906914..904706 (- strand)
Length: 2209
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:906914..906655 (- strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_113:906597..906529 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:906461..906249 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_113:906119..906022 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_113:905952..905857 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_113:905798..905662 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_113:905605..905239 (- strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_113:905175..904706 (- strand)
Length: 470
>GLEAN_8127 class=GenePrediction position=GCSC_113:906914..904706 (- strand)
ATGTCTATCCCAACAAACAGCTCACCTGCAGAGGCCAACGGCTTTCACATTAGCCCGGCCCCTGCGGAAAAGACGACATA
CCAGATCAAGGAGGAGCCCATGCGCAAGCCCCGTAAGATCAAGGTTATTGCCATTGGTGCCGGTGCGAGCGCACTCTGCT
TCGGTCACGAGGTCAACAACAGCGATCTTGACATTGAATTTGTTGCCTACGACAAGAACCCTGTCATCGGTGGCACATGG
TACGAGAACAGATATCCAGGGTATGTGATCCCGTGTCGATGCAGATAAGGATGCAGTGAAGCAAGCTAACCTTCCAGATG
CGCTTGCGACATTCCTTCCGTCTGCTACCAGTTCTCGTGGGCACCCTCTCCAGACTGGACCACTTAGTAAGCATGAAGCG
ACTCCTCCATCGAACTGCCCTCGAGCTCGTTTGACTAACGTTGTCACCTTCAGCTACTCGGGCTCCCGTGAGATTCACCA
GTACTTCTTGAACGTCGCCAAGGAGTTTGATCTTTTGAAGTACTGCCACGTGAACCGCCTCGTCACTGGATGTTACTGGC
AGGAAGAGTCCCAGACATGGCGTGTCCGGGTGCAGAAGCTCGACAAGCCGGATGAGTTCTTCGAGGACGAGTGCAACGTT
CTGTTGAACGCTACTGGTGTGCTGAAGTATGCTCCACGTACCTTGCTTACTGGCTGCCTTAAGCAAGTACACCCGCTAAC
ATCTGCACTGCAGCAAGTGGAAGTGGCCCGAAATTGTTAGGGACGGGAGACGTTCAAGGGCCCGATGATGCACAGTGCAA
ACTGGGACCAGTCTGTCGACTTTAAGGACAAGACTATTGCAGTCATTGGCGCCGGCTCATCCGGCATCCAGATCATCCCT
GCCCTGCAGCCCAGTAAGCAGAGCAGCCTACCTCGACCAAACAGCACAGTTCCCCATATTGATTACTAATACTGCATTGC
AGTTGTCAAGAACCTCAAGGCCTTTGTGCGGAGTACGACATGGGTGACAGCAGGCTTTGGCCAGCGCTTTGCCGGACCGA
ATGGCGCCAACTTCAAATGTGAGCAACGTCTTCAACACAAGTCGGTTTCCTTAGCACTTCTAACGCATCCTCCCAGACTC
GGATGAGCAGAAGGAGGTCATGCGGACGGACCCCAAGAAGTACCTGACGTACCGGAAATTTGTCGAGTCAGAGCTCAACG
GGCGGTTCAGGCTCATTCTGAACGGCACCAAGGAGCAAGAGGAGGCACGAGAGGTCAGCTCCATCCGACCTCAATTTGTC
TCTGTCTCTGACTGCTGACATGCTTCCAGTTTGCCATCAAAGAGATGACGAGGAAGTCGGCCAAGAAGCCCGAAGTTGCC
GAGCAGCTCATCCCCAAGGGCTACGAGATCGGCTGCAGACGGCCAACGCCCGGAAACGGCTTCATCGAGGCCCTGTGCGA
GGACAACGTGGACTTTATTCGCGGTGGTGTCAAGAAGATCACCGAGGATGGCCTTATCTCCGACGATGGAACCGAGCACA
AGGTTGACATCATCGTGTGTGCCACCGGATTCGACGTCACCTGGAAGCCGCGTTACCCGACAATCGGCCGGGGTGGCCGC
AGCCTGAGCGAGGAATGGAAGGATGCGTCCCGGACATACTTGTCTATGTCTGTTCCTCATTTCCCCAACTACTTGAGTGA
GTCGAAAGCCAACGAAGCCTTGATACCCATATCCTTACATGCCTACTAATGGAACCTAGTCTTTAACGGTCCCTTCGGTG
TCTATGGCCACGGCAGTATTCTCCCGGTCATGGAGAAGATCAGCAAGCACTACATGCAGATGATCCAGAAGATGTCAGAC
GAGTGGATCACGGCCTTCGAGCCAACAGAAGAGGCCACCGAGGATTTTGCCGAGCACCGCCGTGCTTTCATCCCACGGAC
GGCCTGGAGTGGCTCATGCAACTCGTGGTTTAAGCAGGGCAGCGTCAAGGGCGAAGTCATGATGTGGCCCGGATCCCGGG
TGCACTTTTTCGACGCCCTGGAGACGCCGCGGTGGGAGGACTACCGTCTAACCCGCGCCAACCACAACAGATTCTACTAT
TTCGGAAACGGTCGTGCCGAGCGCGAATTCGATGGACACGACCTGAGCTGGTACCTCGGTCTGCTCGACGGCGTGGACAA
GCAGCCAATCTACCGGGAGGAGGATGTTTCCGAGTTTCTGGCCCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62