GenePrediction:GLEAN_8129 Details

Name: GLEAN_8129
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:896097..894885 (- strand)
Length: 1213
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:896097..895983 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:895921..895624 (- strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_113:895454..895144 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_113:895066..894885 (- strand)
Length: 182
>GLEAN_8129 class=GenePrediction position=GCSC_113:896097..894885 (- strand)
ATGCAGTCTTTTTTTCGGGTAGATTTGACACTGGCCGTATTTGTCTCTGTGGCCTATGGCCAGGGCGTCATAGCAAGTGC
AAAGGGTGACGTGGGCATAAGCTATGGAATGCAGGGTAAGTTCATGCCATCTTGTCTGTTTTCATCAGCCACAGTGCCCT
AATGTTCTTATCCCAGTTGAGATCAACAACTATGCGGATGCAAATTACATCAACCAGGCCGAGATCGTAGCCAATGCGGT
AAATGCCTGCGGAAGAACGTTACTCGCCGGCGACATCAGCGAGGCCGGTGTCACCGAGGAGCTCCTTGAAACCGGCAACT
ACACCACTACCACGCAAGGCGGCACTATCACAATGGTCATCAGCCAGCGCTACGCTAACGGCAGCGGTCCATTTGCATGC
GATTTAGATGAGGCCAGCAATGCTTTGGGGGCTTATGGGCAAACAAACCTCACGGTTACTCAAAATAACGCTGAGTATGG
CACTGGAGACCTAACTCTAAGTATTACAATGCCAACATACCTTAAATGCATAGGAGGTGTGTCTATTCCACAGCTACATA
GTAAGATTTATTTTTCACAATGGACTAACAATTGCAGCCTCAACCGGAAACATGTGTACCGTTCGCTGTATTAACAACTT
CAGTTTCGGTGGCTGCATCACAGTGCAGCAGACCGATGTTACAGCCAACGTCAACACGGTGGACAACATTGTCACTGAAG
AGAAGAAAAGCGCAATTTCCGCCCAGGTGGTTCAGAACCAAAAAGACCTTCCAGCCGCCAAAAAGGGTCTCGCCGCCGCC
GGCACCACTGAGAAAGAAGGACTATATATTGTAAAGGCTATTTTGGCTGGGGATGCGAATATTGACAAGGATGCCGCGGC
CGACATTGTGTCTTCGGCAGCTTCTGCAAATGGAACTACCACTACAGGCACCAGGAAGACCAGGGCCACCAGAAGTAGAA
AGACAAAAACCGGCACCGCATTTACAAGAACTGGAACAGTAACTGCGGCTGCCGCAACTGCGACCAGGAAGACGAAGACC
AGGACCGGAACGGGGCCTGCAGCTGCTGCTACCGCGAGCAGGAGGACCAGGACCAGGACCAGAACAGCGACCGCGTCTAC
CAATACTGGAACGGTAGCTGCAGCCGCCGCGGCCGCAAACAAGAAGACCAGAACCAAGGCAGCTACAGCTACAGGCCCAT
CAACAACAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62