GenePrediction:GLEAN_812 Details

Name: GLEAN_812
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:187523..188544 (+ strand)
Length: 1022
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:187523..187563 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_132:187804..188124 (+ strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_132:188196..188544 (+ strand)
Length: 349
>GLEAN_812 class=GenePrediction position=GCSC_132:187523..188544 (+ strand)
ATGTCCAGTAACATTTTCCGCATCTTCAAACCAGGAGGTTGGTCTGCCTGACATGCCGCAAGCGGAGATTCTCTCTGCTA
CTTTGACTGCCCAACGCTAAAACTTCCCGCAGAGACCCGGGAAGACCGGGTGCAAAAGCGCAAGGCTCAATTGCGCCAAG
CTCAGCAGTAAGTGTCTGGGGTGTGCTACGTGACGTTCCAGTGCTAAACCCATACCCGAACCTACCGCGATCGCAAGGAC
AAGTACACCAAGACCCTCGAGGACCAGGTTGCCGCAGTCAGGACGAATGAGGCGAAGCTTGTGTACGAGGTCCAGGATCT
CCGGCAAGCGGTAGAAGCTCTCCAGGGTTACATTCGCGACCATGGCATTGCCGTCCCGGACGTTCTTCCCCCCCATCTTC
ATATGCATAAACATCATCCCGACAGCCAGGCTGCTCGTCCGTATCACAGCCACCATCATGCTCAAGATCTGAAACCCAGC
TACAGGCCGCCAGAGCACAGCCCTGGCCAAAATGTCGTCCCATCGGCCCCCGCCTCAGCCGGGTCTGTCGTTCGGATGGG
CGACGTAGACCCACAGGTTGCCGGGATGGAGTTCGTGTTGACGTGAGCCTCTTGCCTGTTTTCTTCGCTTCCCCATTTTC
CTCTGTTGGAGACTTGACGCTTACATCCACAAGGCTCGAGAGTCCCTGTCTGCCACACCTGCACGGCGATCCGGAAAACC
CCGAGGATGCATCCTGCCATGCTCTTACCACAACCGCACAGCTCGTGGCTATGTATCCAGAGCACCCGATTGAATCATCT
GCCGAGCGTGGGGCATTGTGCCAGCAAGTGCCTGGACGCATGCTAGACTCGTTGCTCAGCCTTTCTAAGACGCTCTGTCC
CGAGGACCATATGACGCCGGTCCAAGCTTGGAGCCATATTCGTTCACAGCCACACTTTGGGGGCTTGGAACTTGGGGCCT
TGCAATCGCTGGCGGAGAAGCTGCGCGATTCTGTCAAGTGCCATGGGTATGTTGATGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62