GenePrediction:GLEAN_8130 Details

Name: GLEAN_8130
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:889561..887677 (- strand)
Length: 1885
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:889561..889433 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:889371..889158 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_113:889101..888947 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_113:888873..888524 (- strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_113:888473..887962 (- strand)
Length: 512
Type: CDS
Source: GLEAN
Position: GCSC_113:887912..887677 (- strand)
Length: 236
>GLEAN_8130 class=GenePrediction position=GCSC_113:889561..887677 (- strand)
ATGGAGTCAACAAACGAGAAAAAAGGCTCAGTGGTGGATGTGGAGCAGAGGTCCATCGACATGGAGCATGGAATCAAGCC
AAGTCTCCATGAGCGGCACCTTCAGATGATAGCCATTGCGGGCATGATTGTAAGGAGCCTCCACCGAAGACACAAGGCGA
AACTGGCGCTGGACTAACAGCACAAACAAGGGCACAGGTCTATTCTTGGGTTCGGGGTCTGCAATTGCAAGAGCTGGGCC
GGTCGGCGCTCTTCTAAGCTACGTCGTCATGGGCTTAGTAACCGCGGCAGTCTCGTACACGTCGGGTGAGATGTCGGCAT
TCATGCCCGTTACCGGAGGTTTTACACGGCACGCAGCTAGAATGGTCGAACCGGCCTGTGGAGCTGCGACGGGGTGGAAC
TTCTGTAAGCTTGTGGCCCTGAATCTGCCCACTACGACAATTGATACTCATACTATACAGGGTACAGCATGGCCATCACG
GCACCTGCTGAGATCACCGCAGCGTCTGGCCTGATCGAGTTCTGGGACTCGAGCGTGAGCCCAGCCGTCTGGATCAGCAT
TTTTCTTGTTTTCATTCTCGTTGTCAACTTTTGCGGAGTCCGGCTCTATGGAGAGGTAAGCAGGCAACTCAGTGAGCGTA
TGGACAAAGGCAGACTGGAAGCAAATTGAGGAAAACTGATAGGACTAGTCCGAAGTGGTCTTTGCGACGCTTAAGATCAT
GCTCATCGTCGGTATCATCATTGCCGGGCTCGTAGTCGACCTTGGTGGCGGTCCCGATCACGACCGCCGTGGCTTCCGCA
ACTGGCAACATCCAGGCCCTTTTAACGAGTATCTTACAGACGGCAACACGGGAAAGTTTCTGGCCTGGTGGAGTACCCTC
ATCTCGGCTGCCTTCAGCTATGGCGCCATCCAGGTCGTTGCCATTGCGGGCGCCGAGACAAATGATCCTCGGAGGACCAT
TCCCAAGGCTACCAAGAGGACATTCACCCGAGTCATTCTGTTTTACGTTCTCAGCATCTTCATTGCCGGCTTGATCATGT
AAGCCCATCCCATTGATAATGTTGTCCGGTATCCACTAACTTCTACAGCCGCTCAGATGACGTGAGACTGCAGGTCTCCA
CTGGTACCGCATCTCAGAGTCCATTCGTCATCGCCTTTCAAGAGTCCGGTATCAAAGCTCTTCCGTCCATTATCAATGCC
ATTGTCATCACCTCTGCGCTTTCTAGCGGTTCGGCATGTGTCTACTTGGCGTCGCGCACGCTCTTCGGCCTCAGTCGAGA
GGGTCATGCACCCAAGTTTTTTCAGCACTGCAATCGATTCGGTGTGCCTGTCTATGCAGTGGGCGCAACTGCCATCTTTC
TGCCGCTGGCTTATCTTGTACTTGGAAGCAGCGCGTCCGTGGTCTTCGGCTGGTTCGTCAATATCACGACGGTTTCTGGC
TTGATTGGCTGGGCCGTTCTGGAAATCTCGTTCCTCCGAATGTACTACGCTTTCAAGGCGCAGGGCCATTCTAGAGACGA
GTTGCCCTACAAGAGCCCACTGCAGCCATATACGGCCTGGTTTGCCCTTGTTTTTGTGATCTTGGTCATCTTGTTCTCTG
GTACGTGCACTGTTGTCCTCCCCCTGCTGTTTGCCACTAATGTTGCTAGGCTTTTCCGTGTTTTTCCCTGGACACTTCAC
GGCGAGCGGCTTTCTCACTGCTTACGTGAACATTCCGATTTTCATTGTTCTCTACCTTGGCTTTAAGATCATGCTCAAAT
TGAAAATATACAGCACTACCGAGATCGATATTGAAACGGAATTGGAAATTATTGCCAGAGAGGCCCATAGATACGACGAA
GAGCCAAAATCACTGCCAAGACGGGTTCTGGACAAAATTTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62