GenePrediction:GLEAN_8131 Details

Name: GLEAN_8131
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:886862..884696 (- strand)
Length: 2167
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:886862..886849 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_113:886689..886444 (- strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_113:886351..885844 (- strand)
Length: 508
Type: CDS
Source: GLEAN
Position: GCSC_113:885755..885561 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_113:885509..885333 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_113:885262..885176 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_113:885118..884696 (- strand)
Length: 423
>GLEAN_8131 class=GenePrediction position=GCSC_113:886862..884696 (- strand)
ATGTCTGGCCACGTGTGAGTAGATTCCAGACCACTGGAAATGGGCCAAACTTGACAATAACAGGAATATGATGGACGATG
TCCTCCTTTTGAACTGTGAGTAGAGTAGAACACGGACACGGACACGCATGGCTTCTCTATGCGGGAATTTCGGTACATGG
GTGACGCTAACAGAATTGCTGCAGTACCGTACACGATTCTACGGAGTGCCCTTCGGTTGTTAATATCTCAAGGATCTGTC
AACCAGAAGCCATTTGTTCACCATGTCCGGGAGCGGCTGTCAGAAGCCAAGCCGGATTTCACACCGCCATTGGAGCTTTT
TCCGGTGGGGTCAAGCGAGGCCTCAGTAGTATTGATCGATTATCTCGCTAGGATACGGTGCATATTCTCTTGCAAGCTCG
TGGAAGAGGCCCTGCCACAGTAAGTTTATCCGCCACTCCACTGTTGATGTCAATGTACATGAGAGGCACAGACAACGCTG
ACATACTCAGCCTTACCCATCTCATCAACAGCATCGTCTCAGCAAAGGCAATTTGGACCTCGGGCTCGTCCCTTGAGGCG
AGTCTGGTCAAGGCAGGTGGAGATATTATTCAAGCAATCCAAGCACTCAAAGAGTCGGATCTGCACGCAACGCCAGAAAG
GGAGACATTCCTACGGGCCCTTTTATCGAGCATGCAGAATTGCAGAACCTACTGCAGCGCGAGCGGTCTAGAGTATCTAT
TCAACCGCCCAGAACGGCAAGCCCGGGACGTGTTGATATACATGTACCCACATCTGGAGTCCGAGTTTACTGTGCCGACA
GCGTCCGATTTGATCCAGGTAGATGTTGCCACCCACGAACAAAACACGGGCCAGGTCGAGAGTTTCCAGCTTGGGCATTT
TAGACTGCCTCGACTTTTCAATGGATTTTGGCAGCTAAGTTCTCCCGCATGGGGGTCCGGGACGGCCAAGGAGCAGACAA
GAAGCCTCGTCGAACTGGTCGAGGCCGGCTTGACGGCCGCAGACATGGCCGACCACTATGTAAGCGTCATGGCGGTGCAT
TGTACTCGCCTTGGGCGAACAGAAATAGAGAAAACTGATGGTCTGGGGCTGACATGCTGTCGATCAGGGCGACGCCGAGC
TTATCTACGGAGACTTTCGAAACAGGCTGCCACAAGCTGTTAAGTCCAAGGTGTTTTGCGCGACAAAATGGTGCGTTTTC
AAGCCATGCTCTTTCACTCCGGAATATGTTCTGCATATGGTCAAAGAGCGTTCCAGAAGAGTTGGCGGAGTAGTAGAGCT
ACTTCAGTTCCACTGGCACGATGTGAGTTGCGATTTTACAATTTCAGCATGCCGACGTCTCTAATAATGACAGTACAACA
ATAAAGACTATCTGGACATTTTAGCAGAGCTCGTTCGGATTACTAAATCTCACCCAGAGCTTGTATCGGCAATCGGGCTG
TGCAACTTTGACTCAGAGCATGCTACAGAGGTGTGCGAGCATCTTCTAAAGACTGTTGGTGAGGTTGGCGTAGTTTCCAA
CCAGGTCCAGGTAATAACAGCGAGCCAAAACAGGCCACATCGATTTGTTTAGAAGCAGAGACAGTCGGCTAACTTGAAAG
TTTTCGCTCTTTGACTCGAGACCGCGGAAGAAGATGGCAGATGTCTGCGACAAGTATAGCATCAAGTTGTTGGTCTATGG
AACATTCGTACGGCATCCCTTCCCACCTACACATGCGAGTCTGTGATACTAATTGTTTTGACAGTGTGGCGGCATGCTCT
CTTCGAAGTGGATGGCGAAACCTGTGCCCGAGATATACTCTGCCGAGGTCGGCCTTACACCGTCTCAAAGAAAATACCTC
GACATCATCCTGACCTGGTCATCCTGGGATGACTTTCAACTACTACTAGTTACCCTCAACGATATTGCCCAAAACCACGG
AGTATCTCTGACCAACGTCGCGACACGATGGGTGCTGCAACAGAGGGGCGTCGGTGCGGTCATTGTTGGCACAAGGCTAG
GCATGTCGAACCGATGGAAAGAGAACCTAAAAACATTCGGCTGGACCCTGAGTAAGGAAGAGATGGCAAGTATCGATGCC
GTTGCCCTAGGCAAGGATGGCGAGAAGTCGGACGGGATGCTGGAAAAGCTTGGGGACTGTGGAAACGAGTATCGGGCTAT
GCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62