GenePrediction:GLEAN_8132 Details

Name: GLEAN_8132
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:884028..883642 (- strand)
Length: 387
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:884028..883857 (- strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_113:883769..883642 (- strand)
Length: 128
>GLEAN_8132 class=GenePrediction position=GCSC_113:884028..883642 (- strand)
ATGGCGTCTCAAAACAGTGATGAGTCATTTCAGCTCTATGACCTCCGCGTCGAAGTAGTCTGCCCACCTGGTCGCCGGAT
CATGTGTGGCGCCAAAGACGGGGACTACTTTATGCTTCAGGGTGAGATGTTGTACCTGCCTCCGAATCAAGGCTTCAGCA
TATACAGTCTGGGTAAGTTGCATGGAACCAAGACACAAATTCGAATCGACAACTAACTCTGAAAGCATCGGTTTTGCCTC
TTCTATCCGCCAAACAAAGAATTACTGCAAGAAACGATTGGATCACGTCCGAGGCTCTGGTTGCTTGTCCAGATGCACAC
TGCCCTTCACAGCTTCGAATTGTACGACAAGGCCTCCGGACGTTTGGCCATTCTGAGACGACGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62