GenePrediction:GLEAN_8134 Details

Name: GLEAN_8134
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:867249..865962 (- strand)
Length: 1288
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:867249..867173 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_113:867104..866443 (- strand)
Length: 662
Type: CDS
Source: GLEAN
Position: GCSC_113:866380..865962 (- strand)
Length: 419
>GLEAN_8134 class=GenePrediction position=GCSC_113:867249..865962 (- strand)
ATGTCGGCAATCAAAGCCCCCCCTGATAATTGCGTCGATGAATCAGACAATAACCGCGCGAGAGGCATTGTGGACTGGTG
AGCATAACTTCTCGACAAGGTGTGAGAAGGGGCAGCTTGATGCAGCTAACAATGGCCATTGCCAGCCCTCACGATGACAA
TGCGACAACCGCAGAACCACCCCAAGAGCAATCCGGCGACGAGCAAGGCCCGAACGAGCTGACAGAGTCATTTTCTGCAG
CTGCAGTCAATACGATCAACGGCGCGCGTGCGAATCGCTCGTCCGTCGACTGGCCTGGCGAAGACCCGGAAAATGACTCG
AATAAGGATCTAGTCGTGTGGCTTGAGACTTTCAATGAAAATAAATTCCAGGCGCTTCCAGAATCTGAGAATATTATCCC
GTCCATATACACTGCCACGAGCAAGCCCACCACGTCCAACGGGGACGGCACCGCAAATAACACTTCACCAAGCGCCGATA
GCGGTGATTCGGGCCAGGAAGCAGAGGACGAAAGCGGTGTCAAAAACGAGGCGGTAGACATTGCTTCCTCAAAGATTGGT
ACATGGACAGGCCCAACAACCCCGCCGCCAAACAGCATTGACGATGCCGACCTCGAGCAGGCTCGCAAGCCCGAAAACGA
GTCAAGCACGGAAACTATTACGATCGCCAAGGAAGTATCTCCAGGCCATGACCTCCGTAGTTCGGCCCGCGATACTTCAC
CTCATGGTGCAGAGACCGGCCGTCCTTTTCCAGGGCAGTTTTTAGAGCCGCATCACGAGGATACTCAGAGTTCAATATCC
AGGACGGGTATGTTTCCAGCGTGTCAGAGCTAGCACTGCAGCCAATACTAACACATCCGTGTCGTGCAGCTGATCTCGAC
CAAGAGGACCTGGCCACAGACAGCAACCGGGACAATGGGGGATCGCTCGCCAGTTCACCCCCCCAAACCGCGCCTAGTGT
TAATAGTGACTTGTCATCCTCTAGCGCTGCTAGGTTTGTCAAGAACAGCGATAGAGGCTTTGTTTCCCTGGCCGAGAACA
TCAGAAGATCCGGTTTACTGATCTGGGCTCAAGCCTTGGCCTGCATTGTAATGATAGTTGCAATTGTAGCTCCTTCTCTC
GTTATTACGGCTGCGATTACGGCTAATTCTGAGGTGGCTACGGCTGCGATTGCGGCTAACTCTAAGGTGGCTACGGTTGC
GATCATGTACTGCAAGGATACCCTAGAAGCCATGATGGGATGCTGCTGTTCTAAGAAATCGGACTGTCCTGCCGCCGCCG
CGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62