GenePrediction:GLEAN_8137 Details

Name: GLEAN_8137
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:795361..794628 (- strand)
Length: 734
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:795361..795044 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_113:794897..794831 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:794767..794628 (- strand)
Length: 140
>GLEAN_8137 class=GenePrediction position=GCSC_113:795361..794628 (- strand)
ATGAAGCCTGCCTACCTAGCAAAGGTCTTCATGACCATCGAGATGGTCACAGCTGCGATTATACATGCGGCAGAATACAA
TACAACAACTGCGACACCGTCAGTGATCGCGACCTCGGCGCCTTACCATTTCCACCCGAAGACGCAGGTCAAGCCCACAG
ACTCTTCCAAGAAAGCGTTTGACGGCCTCTATGTGTACCCATACCACACGGCACCAGATACATATGATGCCGCCTTGACG
CCAGATAAAATGCGCGCCCCGACTTCCCATGCCAACTACGGTCCGGTTGGAGGTGTCAGCGGGCCGCCGTACTTTGACGT
TGCCTTAAACATTACTTCGCGAACAACAAACATGGGCTTCCATCTGTCGCCACAAAACGACATCGACTTCGCTGCGAAAT
GCAGCCTGTACGCATTGAATCGGGGCTAGACGGTCCCAGATCTGGAAGTGCTTTCTTTCTACAGAACGGCACTCTGCAGT
GGACAGACGAAGCAGGATTCTTCAGGCCGGCCAGCTTCCACGGCTGGATAGGTAGGTGGCGCCATGCATGGGACAAGTGC
CCAGAGATGACCGCCCGTTCTGACCAACTTTCAGTCTGCCAATGGTGGGACACCAACGAGGACACACCGTCAAAGCCTGG
CCTCCAGCTCTTCTTCCGGTTCAACAGCGCAGGCGGAGTGATACCGTCTACGTGTGCCGATGTTGATCTTGTACTGCAAA
GCACTTCTGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62