GenePrediction:GLEAN_813 Details

Name: GLEAN_813
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:196469..197897 (+ strand)
Length: 1429
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:196469..196516 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_132:196589..197411 (+ strand)
Length: 823
Type: CDS
Source: GLEAN
Position: GCSC_132:197479..197647 (+ strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_132:197714..197897 (+ strand)
Length: 184
>GLEAN_813 class=GenePrediction position=GCSC_132:196469..197897 (+ strand)
ATGACGACCACATCGACACAGGCAGAGACCGTGATGGAGCTCAAACAGGTAAGAAAATCCCCTTGCAGCCGCCAGAAAGA
CGGGCAGTGCACGAACTGACAAGCCCCTTGACTCCTGCAGCGCTCCAAGGGCGAGGCCCAAGATGATGATGCTGCCGGCC
TGGTGGCCGAGCAGGTCTTTCCCGACATCAACACCATCCGCAACGCCATCCCGGCGCACTGCTTCCAGCCGCCGGTCTGG
CGCTCGCTCGCCTATGTGGTCCGGGACCTGTCTCTGATCCTGCCGCTCGGCTATCTGGCCCTGACCTACATCCCCTCGGT
GCCCAACGTCTGGGCTCGGGCGGCCGCCTGGATTGTCTACGGCTACGTCCAGGGCCTCTTCTGCACCGGCCTCTGGATCC
TTGCGCACGAGTGTGGCCACGGCGCCTTTAGCCTGAACCAGCGCCTCAACGACACTGTCGGCTGGGCCGCCCACTCCTTC
CTCTTCGTGCCCTACTTCAGCTGGAAGTTCTCGCATCACCGCCACCACCGCTTCACCGGCCACATGACCAAGGACATGGC
CTTTGTGCCGCGCACCAAGGACGAGCACTACGCTACCCGCGCCTCCTCCTTCTGGCTCGATCCCGACATGCTCGAGGACC
TGCCGGCCTACCAGCTCTTCGTCCTGGTCCTGCACCAGCTCGGCGGCTGGCAGGCTTACCTCTTCTTCAACGCTAGCTCC
GGCAAGGAGAGCCTGCAGCGCAAGGAGACCAGCTGGTTCCGCGTCAGCCACTTTGAGCCCACCAGTGCCGTCTTCCGTCC
CAGCGAGCGGCCCTTTATCGCTCTCTCCGTCCTCGGCCTTTCCATTGTCGGCTACGTCCTGCACCTTGCCTCCGCCGTCT
ACGGCTGGAAGACCATCTTCCTGCTGTACTGGGTGCCGTATCTCTGGGTCCACCACTGGCTAGGTTTGTTCTCCCGAGAT
CGACGGTGGTGTGGAGCTGGCCAAGCTAACCTCTTCAAATTAATCTATAGTTGCCATCACGTACCTCCACCACACCCACC
CCGACGTTCATCACTACGACCCTGACAGCTGGACCTTTGTCAAGGGCGCCTTGGCCACTGTGGACCGTGACTTTGGCTTC
ATTGACCGCCGCATCTTCCACGGCATCATTGGCACCCACGTTGTCCACCATCTGTTCCCGTATGTCTTCTGCTCCTATCA
TCTGCATCATACTTGTCGCCTTCGCGTGCTAATGCCGACTTCTAGTCGCATTCCCTTCTACTATGCCGAGGAGGCCACTG
AGGCCATCAAGCCTGTCGTCGGAGACCACTACTGCCGGCAGGAAGGCTCTTTTGTCGGCTCGCTGTGGTCGACCTTCACG
ACGTGCAAGTACGTCGAGAGCGACCCTGATGTGCCAGGTGCTATGCGATGGGGTAAGGGCCGTCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62