GenePrediction:GLEAN_8140 Details

Name: GLEAN_8140
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:785013..775602 (- strand)
Length: 9412
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:785013..784551 (- strand)
Length: 463
Type: CDS
Source: GLEAN
Position: GCSC_113:784490..784051 (- strand)
Length: 440
Type: CDS
Source: GLEAN
Position: GCSC_113:783983..783927 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_113:783870..783708 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_113:783209..781001 (- strand)
Length: 2209
Type: CDS
Source: GLEAN
Position: GCSC_113:779701..779605 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_113:779480..776115 (- strand)
Length: 3366
Type: CDS
Source: GLEAN
Position: GCSC_113:776008..775868 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_113:775777..775707 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_113:775641..775602 (- strand)
Length: 40
>GLEAN_8140 class=GenePrediction position=GCSC_113:785013..775602 (- strand)
ATGAGCCCTTCTGAGCTTCTTCAATCGGGAACACAACGATCCATAATCTACCAGATTGCCTTGAATGAGCTTCAAGAACT
GGAAGCGGAGCCGTTGTGCCACCGTGTCGCTGCTCGCCTGCTTGTTCACAACTGTCAGCTCCTAGATGGAAAGGACGAAG
CCACGATTCTTACCGATAGTGGCCGCCAGGCACGAGACTTTGTTGACTCTTACGCTGCCAGCCTTGCCATTTGTGACCTA
GAGAGGGGAAGCTTCCATATCCCCTCGGAATGTGAATTGTTCCGCGAACCTGCTTTGAGCAAACTTCCCCTGAGCGATAC
GGCGCAGCTCCATGTTTCTCCTGCCCAGATCAAATCATGTCTCACTGGACTAGGAGACTCGGCCTCTTCCTGGAACACCT
GGGTGAGCTACAGCCACAAGGCTGTCCGCTTCTGCGAGGCGGCTCGCGCAGACCATGAGAAGAGTGAGTGCCACCCCGTG
CCCGTCAAACGACAATCAGAGCTTCACCGCTAACCTGTTACAGCCCAGAACATTCTCATCTTTCAGCGTCTGACGAGGGT
CATGGCTAAGCTCACTGCTGACGTCGAAGCCGAAATTCAGAGACAGACTGAGGCCTTGGATCTAGCAGCCCAGCAGGCAA
GTGAGAAGATCAGCCAATTGACGCCGCAGATCGAACAAATATGGCTGCTTCTGAGTCACATAGGCGCCTACGTTGAAGGA
GACCTGGGCCCTGTCCTGCAGCAAGCTGGCATCTCTGTCCGCGAAGGCTTTCGGGCAGCCGGAGATTTGCAGAGAGTGCT
TGCCGTCATGATCAAAACTGTGCTCGAGAGCAGCTCTCACGCCGCTTTTGCCCACGAACAGTCGCTCGAGCGGGTGTCCC
AACAGGTGAACAGCGAGATGGCCGGGTTCGCATCTGCAATGAACGTGCTATTGTCGGCATCCGCATCGCTACAGAACGAG
CTTGTATGTTTACGACCTGATTCCCAGAATCATGCTACGATACTCGGCTACCTGCTAACAAAACCGCAAGGATCTATCTC
ATCGACATGTGGCAGACTTGTCCCTTCGCCAAGGCTCCCTGGAACAGGTAAGTCCCATCAGGCCTGGTGCCACAGGAAGT
CACATGCTGACAGCTCTCGGCAGGGAATGGAGCGGCTTATCAGCCTGGAAAACACGCTTTCGTCCAGGTATAATGACCAA
ACACGCCTCCTGATGCAGGCGAACAATCTCACAAACGACATCCTCGACACACTGGAGTCGACGGCTACTTCCGCCTTCGG
CATCAAAAATTCGATTTTTCGAGGCCGTACGGCGCAAGGCTGGTGGCCCTACTTTGTTTTTCCAGCACTATCAATTGTAA
TGGGTTCCTACGGACTGCCCCCGTCACTTGTGAGAAACATTGGCCTTCTCGCTTTCGGAGAGCTTCTTGGACTCTTTGTC
TCCTCATACAACCGATTGAGCAAGGCGACACATATTCTTTCCTTTGTCACGAAGATCATGACAACAAACGCAACGACAGA
TTTTGCCTGACTGCTTCTTCAAATGTTCTCTCTCTTTCCTCCTGCGTTGTCTAATTTTCGGTGTGTTATAGGGGGTTCTA
TTTTCTCGGGCATGTTAGCGATGGTTTACGGGCTGTGCGAAATGTGGCTGCCGCAGCAACCAACTAGCGGGACTATCTAA
TCAAAATTCACATCTCTACGGAGTACTCCTGTAATAAATGGATCTTCATACGATCTTGTCGCGACAACCGTGGTATCGCC
AAACGACCGGCAAAGTGCGTGCAATGCGATGGCGAACCGCAAAGGCCGCAAGGCCGCAGTTCACAGTCCTGAGACAGCTC
CCGCAAAACGGCCGCCAGCTGCCAGCATGAGTTCGGAAGAAGACGATACAATTGTTTCCGACGTGCAACCAGACCCCAAC
GAGGATCACAGCAATGGCACAGGCGATGATACCTTTATAGTCGTGGGATCGGACCGGGAGGGGGAGAAACACAACCTGCG
AAACAGAAAACGGAAGCGCTCGTCGATAAAACAGCCGTCGAGAACAACTGCACCTGCAATTCGTCCGACCCGAAAGCGGC
AGAAGGCAGTGAGCGCAGAAGTCGTCTTAGCAAGAGCATCCAAAGCGTTGGAAAATGCGCGTCAGTCAGGAAATAACAGA
CAAACACGCAGTGCTGGCATAGTGCCCATCGATGGCCACACCGAAAACGAAAAGGAGCAGAGCCGGAGTAGCAGATCACA
GCCGGCAGCAAAACGCAAAACACGAACTTCGAACCGTTTAAGAAAAGAGTCCCCTGAAGGGCAGCCGGACGACGCAATAG
ACAACGAAGAGAACGAAGAGAACGAAAATGATGCTGACGAATACGAAGAGGGTGGAGTGCCCGCGCTGGAGGAAACTAGC
GAAGGAGAAAATCCAGAGAACAGCGCCCCTGTTGATGAGACAGCCGAAGAGACGGACGAAGTCGAGGAGGTGGCCCAAGC
AGACATTATGATGACAGAGGAAGACAAGCAGACAATCGGGCTGGACAGCCAGACAGCGAGGGAGATCACAGAGCTAATGA
GCAGCATCGGCTGGTCAGGGAAGCGCACGTGGAAGGTGGCATTTCGACAGCTGCAGGCCAACCCGCAGTCAGGTCTGCAG
CCAGTGACGGCCCAGGGAAAGGAGCTCCGGAAGCAGCTGGCAGAGCTGGCGGCCATGTATGCCAAGACGCCACAGCCGGT
CTTCCCGAGCGAGCGGTTCTTCCAGCCGCTGGCCCAATACGCGTATCTGCTGGTGAGGACCGAAAAGCTGCGCCAGCTGC
GCGACGGCATCCAGCAACGCATCATCAATGCCTGTGACATCTCGCTCGCGCCCGTGGCCGACGACTTGACGTCAAGGGAG
CGCCGCATGCGTGCGCTGCTCTGCGAGGATTTGGCCACCTTTGTCGTGCCGGAGGCTGCCGCGCTGCTGGAGACGACGCT
TATGTTGGGTGGCCGTGACGACGATGACGACATCTGCCTCGACGGCTTCTACGTGCCGCTCGCCGTCTGCCAGCTGAACC
GGGGCAGTCTCGAGATTGCGGCACAGGCCTCATCCTGGCTCGCGCGGCTCGAGGCTGCCCTGGCGCACGAACTCGGCTAC
CGGGCCGAATATGGAGACCAAGCTAGCAGCGGCGACGAGAACCAGGACCAGGCTCGTGACGGCGACGACGTCGGCCGCCA
GAGGCAACGCAGCCGGCTCGGCGCCAAGAAGGAGGCTCGGCGACGGCTGCACCTTCTCGTAAACCGCGTCCAGGACGAGA
TCTGGACGGCCAAGATCGAGCTGGAGCGCAAGATCCGCCTGGGCGACATGCAATTGCTACGGACGGCCCGGCTGAAGGAA
GTGGAACAGCAAGAGGCAGCAGAGGCGGCAAAGGCAGCAGCCGCAGCACTGATCGAATTTAGAGACATGCAGCCGGCATC
AAGAGTCGCCAGCAGCAGACAGACGCCCACGCGGCCTATAGACGACGACGACGACGAAGTCAGGCATGACGCACACGAGA
ACATGGCCGTGCAGCGTGTTGGTCGGCTGGCCACGCCGCCTTGTCTCTACAGCGATGGCTATGATCAGCAGAGCACCATG
ATTGTTTCGCCGACTGAGCCAGTAGCTGTTTCCATAGAGCGGCAGGCTGAGCCGGCGATGCAGCTGCAAACACAGCCGAC
TCCGACTCGACCGACTCAGACTCAACCGGTATCGCCTCGGCCAAGTCCACCACAAACAGCCCAAACGCAACCGACCCAGA
CTCAACGGGTTCTGTCTCGCCCAAGTCCACAAACACAAGCTCAAACACAACTGCAGACAGACATGTCTGGAAAGACCTTC
AGCGCAGAGGAGCGAAAACAAATCTTGAAGCACCTGATGAGGAGGAAGGAGCCCAACCTGGTCCGACTGGCCGCCGAGCT
CGGCCGCGACCTGATGGACGTGGCGCACCAGGCTGAGATAATCAAGAGCGCGGCACGCACAATGGCGGCGAAGAAGCAGA
AAGCCATTCCCCAGTGGGCGGGCGCAGGCTGTCGGCTGCCGGGGTACAGCGGGCTGTGACGGGAATTATCTGCCTGACTG
CCAAGGCAGTAGGTAGCACTACGGAGTATACACATTTGCTGGAGCGGGAGCGGGAGTTTTGGCCGCGTTGTCTTATTCCA
TGATACCAACTTCTCCTTCTTGACCGTTGCCAACATGCTTTCAGAGGGACGTCCGAGGGAGGCTTGAGACAGGGGTAAGA
GCCCCTAAACGTGCAGGAGCTTTCTCCACTGCTTCCTCCGCGACAGTAGCGCTCTGGGCCCGCGGCCATTGGCCTGTTGC
ACGCCGGTTGGTTCTGGCCCAGCTGCAGGTGCCTCTCCTTTTCCGCCAGCTGCATTCGGCAGACGGCAACAGGTCGGTGG
CGATCCTGGAGGCCAGCTCCACTCATACGGTCGGGTCTTCCTGCGTCATCGAAAACAGAGATGCGAATGCACAGTCCATA
GGTCGTATGTCGCACTCCGTACGTCGTCAGGACATGGCGTGTGGACAGTGTTCTTCTGCTGCTCAGAGCGTCCCTCTTTT
GTTCGTATCTACTACTCCGTACACCGTGCTTCGACAGTCGGCATTCCGGTAGCGGTCGCCGCATCCTTGCAAGGAGTATT
TCGCTCGCCAGCCTCCACACCGCATCACGCTGCACATCTGCTTTCGCTGTGCCCACAATCTGACCGTCTACGACGTATGT
ACTATGTAATCTGGCAGCCAGTCGCGACAATGCAATGTCGCCTAGCGCGGGCTCCTGCTAAAAACCGAACACGTCCCGAG
CCCCTAGCTCGCTTCTAAAATAATAAATAGCCTGTCGTCTGGCACCGGCTGCCGGCTGTGGCCCTGGCTGTTGCTGCTGC
TTCTGTAATAGGGGCAAGAACTCCGTACGGTTGGCCGTTGTGCCCGCCGTCGTTCCTTCCCCCCCCTGACAGCACAAGGT
CTGTGCTCCTTCCCTCCGTATCCCTCTCTCTTCCATGTGGCCTCTGCGTTCGTCCACCACCGATTCTATGCAATACCTTT
CCACTTTAATTTTTCTTCCCCTGTTCTCTCTCGACCGCAATTATCCCCTTCTTTTCAGTTCTTCCAAATCGACCGCGCTT
CCTCCTCCCTCTCTCTCCCCCTTTCTCTCTGCATCAACGCAATTCCAAACCGAGGCAGCTGCGGTTATTTCTGCTGTTCT
GCTCCATCTCCTGCTCTCTCGACGCTGCAGCTGTCTTCCCACCAGAATCCTGTTGTCTGGCCCCTATCTCTTTCGGCCTG
CTTCTATTTGGTGTCCAGCTCGCGCCACTCAGGAGCTCCATCGACCGCATTGCACCAGCTCTTGCATCGGCCAACTCGCC
CAATTGGCACCCGTCTTTGATTGCTGCATCAACGTTGCAGATACACGAGGTGAGTTCGCAAAGCCGATTCGCACATAAAA
TCCGTCGGATTGTCGCCGCGGCAGACGCGCTACCACGCGGTTTTATAGCCTCACCGAGACGATACAGGATTGGCTGCTAA
CGTCTGCAACTAGACTAAACAAGCACCGCTTGTTTATATCGGCCTGGTCTCAACGACGCCGCCCCTACCGTCCTTTGCAG
TCCCCATGGCCGACGCCGCCGTTCTCGACATGGCCCAAAAGGCTGAGACCCCTGAGCCTCCTATTTCTGAGCCAGCTCTC
TCTGTCGTCAATTCCTCCACGGCCTCGCCGGTGTCACCCGTCTTTCCAACGTCCCCGGGAACGCCGGCCACACTGGCTGT
CCCCACATCGCCTTCATCAACGGATCTTCCCAAGTCGCCGACAAAGCTGGCTGCCGCAAAGTCAGCCACCGGAGCTCATG
CCACGAAGCGGCCATCGAGCACCGTGCCGCCCTCTACCGCACGCCGCACGGGTCTCACCAGTGCTGCGCCTGCAAAGCCG
GCTTCATCGACTGGCACGCATCCGCGCACCAGCACCGCCGCTGGCCTGAACAAGGCTCCAGCACGCCCAGCCACAAGCAC
GTCCGGCAGCATTGCCAAGCGTCCCGCCACGGCCTCGTCGAATGCCACCCACAGATCGAGCACCTCTGCATCGGAAGATG
AGAAGAAGCGCTTTGGCTCGAGCACTGTCGCCCGCCGCACGTCCACGGCCCCGGGCACTACTGCTTCCACGACCACCAGA
ACGGCCAGGCCAGCGGGTGCTACCACCCCTCAGCCTCCTTCTGGCACGGCTGCTGCGGCGCGGAAGCCCCTAGCCACCGG
CTCCACGTCCTCGACAAATGCACCCCATGGCGGAACACATGCCCCAGTACATAAGCCAAGCGTCAGCTCTGTCTCCTCCT
CGAACACGGCTACCACCAGGACGACGGCGAGCCGCCCAGCCGCAACAGGTCTGGTGGCTGAGGCCAAGAAGCGCTTGTCC
ACGGTCGGGGTTTCGGCTGCGTCGACATCGGCCGCTACCCGGCACATCAGCCGCCCGTCGATGCACAGCTCGTCTTCATC
CTCTGTCGAGACGGCCAAGGAAACGGATGACCTCCGGGAAAAGCTCGCAAGCAGCAAGGCCGAGACCACAGAACTGAAGG
CCCAAATCGACTCTGCCAAGGAGAGAATCGACTTCTTGAACGATCAGCTCCAGAAGACCACGCTCGAGGAAAAGGATCAG
GACAACCTGATTGCCGCCTTGAAGTCCGAGCATCAGGAGGAGATTGCGGCGCTGAATGCACAGGTCAAAACGATTGAAGA
GAAGCTCGCTGTGGCTGAAGATGAGCTGGCCAAGCACAAAGCGGAGGCTGCTGATATCACATCGTCCAAGGATGCTTCCG
ATGCCGAGATCAACTCTCTGAAGATGTCTCTTGAGGCGCTACAGAACGAACACAATGCCAAGCTAGCAGAGAAGCAGGAG
GCATTGACCAGCGCCAGCGCGGATCATGCTGCTGCCCTCGATGCCCTGAAGCAGTCTCTTGCTCTAGAGCACCGGGAGGC
TCTTGCTTCCCTAGAGGCGAAGCATGCCGATGCCTTGAAGGAAGGCGAGACCGCGTCGTCTTCTGTCCATGAGCAAGCTG
TGGCCGAGCTGACATCCCGCCACGAGGCCGCTCTTGCCGAGCTGCAGGCGAAGATTGACAACCTCTCGGCTTCGGAGGCC
AAGGCCGGGGAGGCCAGCACCGCAATGACTGCACTGGAGAGCGAGATCAGCGAGCTGAAGGAGAAGCTTTTGGCGTCTGA
GAAGGCTGTAGAGGATGCGGCGGCGCAAGCCGGCGCAGTGTCGGACCTGGAGGCCAAACTTCAGGCGGCCGAGAACGCCG
CTGCCGGAGCAAAGGCAGAGCTGGAGGCAAAGGATGCTAAGCTCAACTCCCTCGAGGCCACGGTGGCGGCGCTTCAGGAG
GATCTGGTTGCTTCAAAGGCGGCCGCCCAGAAGGCCGTGGAGGCTCTTGCAGCCCTCCAGAAGGCGACTGAAGCGGCAAG
CGAGGAAAGCGGCAACAAGGATGCAGCGATGGCCCTGATCAAGAGCCAATACGACACTGCCATCGAAGAGCACAGCAACA
AGTTGAAGCAAGTGTCGGAGAAGTACGAGGCCGAGATCGAGGTCCTGCGGGCGTTCGAAGAGAAGTTTCACAGCCTTGAA
GCACAGCACAACGAGATTGTCGATTCCATGTCCAAGACCGAGGATGTGCATACAGAAGCGCTGAGGGCCGCAGAGGCCAA
GCACGCGGCCGCGTTGGAGGAAAGCACGGCAGCCCACCAGAAGGAGATGGAAGATCTTCTGGCTCGCCATGTAAAGGAGC
TTGAGACAGCGATGCAGTCTGCCACCAGCTCGTCGAATGACGATCACCTGGCCGAGCTCGCCACGCTCAAGGCAAGCCAT
GCAGAACACGTTGACAACCTGCAGATGGAGTCGGCAGAAGCCCTGGCTAAGGAACTCGATGCCCTCCGCTCGGCTCACGC
AGAGGCCATCGAGGCCCTGAGGGCAGAGCATGCCTCGGCAATCAAGGAGATTCAGGACAGCCATGCGGCGGCCATCAGCG
CAGCCACGGCGGCAAACGAGGATACCTCGGCAGCCAAGCTCGTGGAAGTGAAGGCGGAGCTTGAGAAGCAGCACACAGCG
CAGCTCGAGTCGCTCAAGGCAGAGCTGGCCGCGCAGCACGAGGCGGAGCTGCAGAAGAGCACTGGGGAGGCGTCTGCAAC
GGTTGCAACAGCACTGGCCGAGGCGGCACTCGCTCACAGCAATGCGATGCAGAAGGCAACGGCCAGCTTGGAGACCGAGC
ACGATGCGGAGATGGGGAAACTGCTGAAGATGCAGACTGATGCCATCGAGAAGGCCAAGAGTGAAGGAGCTGCGGAAACA
GCGGCACTGAAGGAGGCCCACGCCAAGGAAATCAGCGAGCTGGCGGCACAGCAGGCGACAGTTGCTGAACATGCGGCCGA
TCTAGAGAAGCGTCTGACCCAGGTGACCACAGCGCTGGAGGGCGCGCTCTCGGACGTGGCCAAGGCCAACGCAGAGAGCG
ACGCGCTCGGTGGGGAGCTGGCGATGGCCAAGATGGCCAAGATCGAGGCTGAGGCTGCACTAGACGCCAGGGCATCGCCG
CCGGGTGTGAGGGAGCTGGAAGGTCTGCGGGCGGAGCTGTCAGCGCTCAAGAAGACGCACGAGAACGAGCTGTTTGCGGC
CAACTCCAAGGCGGCCGATGCCAGCGACGGGGCACGGGCTGCGCAGGAGGAGCTCGAGCTGCTGCAGAAGGAGCTCGAGG
CGGTCAGGCTGGAGGGTGAGGCCAAGGTGAAGACGACGCTGGCCGACTACAAGGAGCTGCACGATTCGATGACCCAGATT
GTGGAGGAGGAGCAGAACAAGAACTCGGCGGCGAAGCATACGATCGAGGAGCTGCTCGCACAGCTCAAGGTCAAAGAGGC
CGAGCTGGCCGAAGCAAAGGTAGGCAGGCCGTTTTATCTGGTCTTTGCGGCAGCTTCTGTTGTTCCGCTCTTCTTGACGC
TGCTGTATTTCTGGGCGTTCTAGAGCTGTCGCTGACTAAGCATAGACACACCAGGCGGGCAAGGGCCTGTCGGCCAGCCA
CCACGCCGATGCGCCCAGCGATGACGCAGCCGCCGAGTCTGGGGCCCCTGCCACGGCAGAAGGTGAGCCCAGAGAGCCAG
ACCACTCGTCGGCAGCCCTAGCTTCGGTGCGCGAGCCGCCGGTCCCACGCGAAGGTTGCCGTTTAACATAGTTGTGGACA
AACAAGTGCTAATGCATCGTGCTTGCGCCCCTGCAGATATCTAGAGCTCGAGTGACCGCGCGTGGGCTTCAGGAGCTCGA
CGATGAATTGCGCGACCGAAGCGCCCAGTAAGTGGATGGCGATGGTCCCGACACGCTCACACTCGAGACTCAATGCTAAC
CCGATGACGAAGAATGCTGAAATCCATCGCCAATATTACGCATCTCGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62