GenePrediction:GLEAN_8141 Details

Name: GLEAN_8141
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:774962..773262 (- strand)
Length: 1701
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:774962..774205 (- strand)
Length: 758
Type: CDS
Source: GLEAN
Position: GCSC_113:774048..773262 (- strand)
Length: 787
>GLEAN_8141 class=GenePrediction position=GCSC_113:774962..773262 (- strand)
ATGAGCTTGACGACAGCTTCTGCAGGCGTCGCAGTGGCGGCGCCGGCGTCCGCTCCTGTGTCGGCAGCTGGTCATCTCCT
GAAGTTGGAGCGTCTTGGCGTGGCAGCCCAGCAGAGCGAGCAAAAAGAGCAGAAAGAGCACAAGGAACACAAGGAGCCAA
ACGAGCACAGCCATCACAACCACAACCACAGCCATCATCACCACCGGCACCACCACTCCTCCGGGGCTAAGCACACCTTT
ATCCGTCCGACGAAGCGTATTTTTGACGGTCCCGACGTTGCTCGCTTTCTCGTCTCGACCGCCTATCGCGATCTCGGCCT
CTTTATCCTGCAGCTGAACCATGCGATGTGTCCGCGCGCAACGACCCAGACAATTCCGACCGCCGCCTCGACCACCGTCT
TCACGCTGCAGCAGCCGCGCGCGGATCCGCCGTCGGTCTGCCGGCTACAGCAGCTGCTGGGCCGCCTTGACGCGCTCATC
GACCAGGCGCCGCCCGATCCGGGTCCACGGCGTTTTGGCAACGCCAGCTTCCGGACGTGGCACCGGCTTCTGGCCGAGCA
GGCCGACGGACTGCTACAAGAACTTGTGGGGGTGGGCGGACAGACCGACCAGACCGACCAGACCGACCAGGCCACGGCCA
TGGACGAAGTCGCCGCCTACTTTCTCGGCAGCTTTGGCAGCGCGCAGCGGCTCGACTACGGCACCGGCCACGAGCTCAGC
TTTCTCGCCTTCCTCGGCTCCCTCTGGAAGCTGGGCGTGTTTGCCGACGGCGACGGCGGGCCGGACGGCGACGCTGTCGA
GCGCAGCATCGTGCTGGGCGTGATTGAGCCGTGAGTTTTCTTTTTCTTTTCTTTCTTCTTTCTTTCTTCTTTCTCTTCAA
CTTTACTTCCTCTCCCCTTCTGCGTCACTAACAGCTCTAGCTACCTCCGGGTCGTCCGCCGACTCATCCTCACCTACACG
CTCGAGCCGGCCGGCTCCCACGGCGTCTGGGGTCTCGACGACCACTTCTTCCTGCCATACATCTTCGGGTCGGCCCAGCT
GACACGCCCCATCGCCGCGGCCACGGCTGCCAGCACGCCCATGCCGCAGGAAGGCTCGGCGCCGGGTGCACCCAAGCCGG
CCGATGTGCTGCGGCCGGCAACCGTGGCCGTACAGCGCCAACAAAACCTCTACTTTGCCGCCGTCGGCTTCATCGACGAC
GTCAAGACCGGCCCCTTTTGGGAACACAGCCCGATCCTCTTTGACGTCTCCGGCATCGCCGACGGCTGGGGCAAGATCAA
CAAGGGCATGATCAAAATGTACAACGCCGAGGTGCTCTCCAAGTTCCCCGTCGTCCAGCACTTTGCCTTTGGCTCGCTCT
TCGCCTGGACCGCCGACCCCGACGCCGAGACACCCCAGCACTCCGTCCACATGGCCAGCCAGCCAGCCACTGCTTCCACC
GCCACCGCTACCGCTACCGCCACAGCCTCGGCCACCAACACCAACGCTGCCGCCGCTGCTACTGCTGCTCCCTGGGCCCA
GGCTACTCGCATGCCCGGCACCCTTGGCTTGCCCGGCCCCGGCATCCCCTACTCTCGCGTGCCAGCCAGGCCAGGCCTGC
CATCGCGGCCAGGCTCCTCTGCCACAGCCACACCCACATCCCAGGACGGAGGCTCGACAGCAGCACAGATCGGCCTGACG
AGAGCTCCCTGGGCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62