GenePrediction:GLEAN_8142 Details

Name: GLEAN_8142
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:760800..759173 (- strand)
Length: 1628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:760800..760725 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:760666..760511 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_113:760440..759173 (- strand)
Length: 1268
>GLEAN_8142 class=GenePrediction position=GCSC_113:760800..759173 (- strand)
ATGCTCATCAACGGCGAGAAATGGGCTTGCGACGCCTGTGTACGAGGACACCGAGTCAGCAATTGCCAGCATTATGGTGG
GTGCAATTCCTCTTATACCCGACTCTCGCGCACGTCTTGCTAACTGTCCTCCAGAGCGCCCATTACAACATATCAACAAG
AAAGGTCGACCGGTCACCCAGTGCCAGCACTGCCGCTCGCAGCGAAAGAACCGCTCGGCCCACGTCAAGTGCGACTGCGG
CGAGAAAACAACCAAATGCGTTCATTTGGGCGCCATAGACGGTCACCGAGGTAAGAGCGGTCCTCGACCGACCTCTCTGG
ATGATGCTGTAGCTATAAGATGCTAAACGCCAACCTACAGAGAGCTGCTGCTGCAACCACGGCGGTCGGTGCAGCTGCTC
CTTCAAGAAGGATCCTGACTCCAGCTCATCCGACATGACGGAAAAGGGCTCAGCAGCAGCCAAGACAGCTTCGGCTGCCA
CCATGTCGACCACCGCTTCCAGCCTGGGAACATCAGGCCTCAGCTCGCCCAAGAGCCCCATTCGCCGCCGCCGCGCCAAC
ACCACTCGCTCCGAGGGTACGCTCACTTTTGACGAACACGGCCGCCACAAACCAGTCTCTCACAAACATGCAAAGAGCCA
AAAGACGAGCCCGTATCCCAGCAGCCGAATCAACTCGGTGCGTAGCACTGGCGTGCTTTCGAACTTGATGGCGGCCTCAA
AGTCCGCTAACAACGAGGATGAAGCGGAGGAGGACGATCACAGCAGCGGACTCGGCGAGTCTGACAGCGGAGCCGACGAT
GGCGGGGGCTTCCTCTCCATGACCACGCCTGCTTCGACTACGGCAACCAGTGTTCCGCTGTCCTTTCACGCGACAGAACA
TCAAGAGCAGCGGCTATCGCGGTCGGAGACTACTTCGCCCCTGCACCTCGATAGCAGCTACCCGCAGCCGCACCAGCTGA
ACGACAACAGCCAACTACCCCCTCTCAACATGGGCGCTGTCGACTACATATCTTATAACTACAACGCCTTCGACAGCCCG
GATCAGCCTCTCTTCAGTGCTGGCCTCAAGGCGCCAGCAGTCGACTGGAACCAGTTTTTCGGCGCCAACAGTGCCAACGG
CATTAGCGGCGGCAATGCTGGAAATGAATCCGGCAAGTTCGGCAACACCGGCCCATTTGGGTTTGGGAGCACATTTGGAT
ACGAGTACAACGGATCCGAGCAGGCACCCACCATGACCACGGCCACGTCGGGAGAAGTGTCCGAAGCTGAGGACTTGATG
GTGCCCGGCGTGGACGACTACGACTACGACTACGATGGGGCCACGGATGCCGCAAGCAGTAGCGTTGCCTTTTCCCGCGC
CAACAGCAGCTACCACCTGGCGTCTTCAGTAAATATACGCCACGACTTTAGCGATATGCGCCTAAACAAGGCTGGCAACA
AGTTCCTCCCCACGCCCTCAGCCGCCACCACCGACGATGCTGCGGCCTTAGCAGCCGTCGGTGCGATGGCGCATGGTGCC
ACTCTCGAAGACGACGATGCTGCTATCTGGATGCCGGATTACCAGGGCCTCACATCCATGACCGAATCGCCAGAGTCCGA
CGTGATCTCCTTCTGGGGGTCGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62