GenePrediction:GLEAN_8143 Details

Name: GLEAN_8143
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:753999..753609 (- strand)
Length: 391
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:753999..753987 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_113:753855..753676 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_113:753616..753609 (- strand)
Length: 8
>GLEAN_8143 class=GenePrediction position=GCSC_113:753999..753609 (- strand)
ATGGCCGGCTTTGGTACGTCGACCTTCCCTATCATCCTACCCCTAAAAGGAGATGGGGGCCCGTGATACAGACGTGCACG
GGGAAGGAGCGCCCCGCCGAGATGTGACAGGAGCTAACGATGAATCGCTTGCCCCACCTTGCAGTCGACGCTCTCAAGAA
CTTGAAGACCAAGTTCAAGGCCATCTTCAAGAAGAAGGAGGCGAAGCCTGCCGAGGAGACGCCGGCCACCGAGGCTGCCG
CCGAGGCTGCACCGGCAGAGACGGCCGAGGCTGCAGAGCCCGCCGACGAGGCCAAGCCAGCAGAGACGCCTGCTGCTGCT
CCCGGTAAGCCTGCCTGCCTGAGATTGCAAAATGTAGCGATGACTAATACAGTGGAACCCCAGCCTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62