GenePrediction:GLEAN_8145 Details

Name: GLEAN_8145
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:741027..739848 (- strand)
Length: 1180
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:741027..740598 (- strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_113:740530..739848 (- strand)
Length: 683
>GLEAN_8145 class=GenePrediction position=GCSC_113:741027..739848 (- strand)
ATGCGCTGGCACCGGAACCCCTTCTTCCACACGGCGGTGCTTCCACCCTCCGTTGCGCCGTCTGCCCGCCAGTCCACTGA
TCTTGACGGAGCAACCGCCGCGGCCGCTGCCGCAAACAGGGCCGCCGTCTTGGCCGATGACGTCGAAGCCATCGCAGCCA
CTGGGCCTCAAGCGACCTCTTCTGCCGTTGCCAATGTCGATAGCACTCCCCAGGGCCTCCTCGCCGAGGCTGCCAAGCTT
GCTGTCGAACAGACCCACCACCCTCGTCTCAGCTTCCTGGCCCGCAGACACCATGAACCCAGCATTCCGCGCCTGACCAT
CCTCGAGCCCAGTGACCACTTGACGCCGTACCAGTTCTTTTACATCTTCATCATCGATGGAATGGGCGCCTTTATCCTCT
CTGGCGCCATCAACTTTGCCATTGCCTATGGTAGGTCGTCTTCTGGCCCCCCTTGCTCCCTGGCAAGCCATCGCTGACCG
GTGATCTCTCCTTATAGCAATGTATAAAACAATCAACTCGGACAAGCACCCCATCCGGCTCTTTCAATTCCCAAACACCA
TAGCCGGCGATGCTGCCCTTACCGTCTTCATCCAGTGCGTCATCACCTGGTTCATCGAGCTGATTCTCGTGAACCGGGAC
ATCCGATCCGGCCACATCCAGCCGATCGGCTTCATCCCCGAGCCGGCCAATGCGCTGCTCCGCTGGTTCTTGCTGCTCGA
TCGTCTGCCTGCGACAGGCAGCAGTGGCAGTGGTAACAACGGTGAGACCAGCGGTAGCGGAAGCGGTAACGCTAGCGGTG
GTGATGATGAAATCTTCCGACCCCTTTCAGCACCGCACGACGCCAACTGCCGCTGCGATAAACACGTGGAGCCATATGAA
CCGGGCTCACTGAAGCACTGGATGTTCTTCTTGGTATCGCAGCTGATCCGCGCGCTAATGCTGGGCGTTCTCGCTTTTCT
GCTCGTGTGGGGGCCCGCGATCGGCATCATGACGGCCGTGGGCGATCACCACAACGGCGACTGGTGGTTTGACTCGTCAT
CTTGGGCACCGCCCATCTTCAAACTCATTTATGGCGGCGTGCTTGCCCTCCTGACAACGCCGTTGTTTGTCATATTCTGG
CTAGTGCGCTGTGGTTGGGCTCTGCAGGCCAACCAGCGACATCTGGACGAGGTGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62