GenePrediction:GLEAN_8148 Details

Name: GLEAN_8148
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:726448..725211 (- strand)
Length: 1238
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:726448..726446 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_113:726325..726284 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_113:726220..726105 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_113:725964..725211 (- strand)
Length: 754
>GLEAN_8148 class=GenePrediction position=GCSC_113:726448..725211 (- strand)
ATGGTTAGCGTTGACCCCCACGCAGCATGACAACGTGGAAGCAATCGGCCGAAGAAGGCGATCGGTGGAGGTGCATTGCA
AGGCTGGGCCGACCTGATGCTGACAATGTTGTGATGAGTGCAGGCAACGGGAACGATTTCGAACGTCAACCATGACGGCA
TGATTGTACGTTGTTTGTTGTCAGTTGAGGACGTGAGAGATGCGGTGTGCTGACAGGCTGGACCACAGCATGATGTAGCC
CTTGACTACTACGGCCGACGGATGGCGACATGCTCTTCGGACCGGAAGATTAAGATTTTCGAGATTGAGGGCGAGTCTCA
GCGATTAATAGAGACACTGAAAGGGTGAGTGGGGCAAGAGAGGAGAGAGCGAGGGAGAGAAGAGAAAGAGGAGCGAGACG
AGACAGAGAGATTGGTGAACGGGACGGGAAGAGCATTGGGCATCGGGCTTTGCTGACGTGCGGTCTGTGGGCCTGATCCT
CCAGACACGAGGCAGCGGTGTGGTCGATCTCGTGGGCGCACCCCAAGTACGGCAGCATCCTGGCATCGGCCAGCTACGAC
GGCAAGGTGTTTATCTGGCGCGAGCAGGGGGGTGCGTGGCAGCGGCTGTTTGACTTTGCGCTGCACAAGGCGTCCGTCAA
CCTGGTGTCGTGGTCGCCGCACGAGGCGGGCTGTCTGCTGGCGTGCGCGTCGTCGGACGGGGCGGTGACGGTGCTCGAGT
TCAAGGACAACAGCTTTGAGCACACGACCTTCCAGGCGCACGGCCTGGGCGTCAACGGCGTGTCATGGGCACCGGCGACA
TCGGCGGGCAGCCTGATCTCGAGCAACCCGTCGCCGGCAGCGGCGGGCAACCGGCGCTTCGTCACCGGCGGTAGCGACAA
CAACCTGCGCATCTGGGCGTGGGACACCGCCGAGAGCGGCTACGTGGCCGAGGGCGAGCCGCTGACGGGACACACGGACT
GGGTGCGCGACGTGGCCTGGAGCCCGACGGTGCTGCAGAAGAGCTACATTGCCAGCGCCAGCCAGGACAAGACGGTGCGC
ATCTGGACGGCAGACTCGCTGGCGCCGGCGACGACCGGCTGGGCCAGCAAGGTGCTCACCTTTGACGAGGCCGTGTGGCG
GGTCAACTGGAGCCTGAGCGGCAACGTGCTGGCCGTCAGCACTGCCAATAACAAGATCACCATGTGGAAGGAGAACCTCA
AGGGCGAGTGGGAGTGTGTCAAGACGATGGGGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62