GenePrediction:GLEAN_8149 Details

Name: GLEAN_8149
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:720814..718076 (- strand)
Length: 2739
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:720814..720308 (- strand)
Length: 507
Type: CDS
Source: GLEAN
Position: GCSC_113:720239..719035 (- strand)
Length: 1205
Type: CDS
Source: GLEAN
Position: GCSC_113:718958..718076 (- strand)
Length: 883
>GLEAN_8149 class=GenePrediction position=GCSC_113:720814..718076 (- strand)
ATGCAGTCCGACCAAAAGATAACCGTTGCCGCTCGTTGGCTCCGTGGACAGCCCACCGCGGCTACTGGCCTTGATGTTGG
CACCACCTTCGGCCTGCCCTGGCCACGTGGCGATTGTCCTTCCTCTGCTATCTTTTCCTGTCACGACGATGCCGGTGCTT
CGGTACCGCTGCAGTCATGGTTGACGGCCTTTTGGCCTGACGGCTCCATCAAGTGGACGGCGCACGCCATTGTTGTCTCT
GGCTCGGACGCCTATCACGTCGTCGCCAGACCCAATCGGGCGGACCAGAAGAATGAGACCAGCCAGACAGACAGGGCTAT
ACGCGTGAGCGAGGCTGATACTGCCATCATCGTCGACACGGGGAAGATCAGCGTCGAGTTTGCCAAGTCGGGCGGACATG
TCGTCAAGAGCATCACCGCGGCCAATGGAACTGTCATCGGAAGTGATGGTCACCTGGTCCTGCTGTCATCCAGCGACGAT
GTCGGACAAGACGGCAGTTTCCAGACCGTCAAGTCGACTCAGTCGTTGTCGAGCAGGACGGCCCGGTTCGTGTTGTCTTG
GCTGTACGGGGAAAGCACGAGGCAGTGGGCACGGTGGATGGAGATGGCACCCCCTGGCTGCCCTTTCTCCTTCGCTTTTA
CCTCTATGCCGGCTCCGAGGCCGTGAGGATTGTACACACCATCGTCTATGACGGCTCGCCCACGACGGCCATCCGCGGAC
TCGGACTGCGCATTCACGTGCCTCTTGCCGCTACACAGCTGCACAACCGCCACGTCCGTCTGGCTGGCGTCGGCGGGGGC
GTCCTGTCCGAGGCTATTCACGGTTTGACCGGGCTGTGGCGGGATCCAGGTGTTGAAGTGCGCAAGGCCCAGCACGAGGG
CAGGCCTGTGTCGATGCCGGATGCCGTCCCTCCCGACTTCTCGGCCCTCCATCGCTGGGTCCCGGCCTGGAACGACTACT
CGCTCGTCCAGCTTTCACCCGATGGTTTTAACGCCCGCAAGCGCACAAAGGCCGGCCAGAGCTGGGTGAAGATTTCCGGA
GGCACACGGGCGGGCGGCCTGGCCTTTCTCGGGTCTGCGCACACTGGCGGTCTCGCCGTCGGCCTCGCCAATTTCTGGGA
GCGCTACCCGACAGGAATTGACGTTTCTGATGCTGCCGCCGATGCCACTGCAGCCGCATCCTCTATCACCCTCTGGCTCT
ATAGCCCGGCAGCTCCTCCGATGGACCTGCGGCCATATCACGATGGTCTCGGCCAGGCCGGCTTTGACGACCAGCTCGAT
GCCCTCCGGATCACGTACGAAGACTGGGAGCCCGGCCTGGGGTCGGCCCACGGCATCGCACGCACCAACGAGATAATCCT
CGTCGGCCTCGACCACACGCCGGCAGCCCGTGAGACTGCCCAGCTGGTCGATCTCATCCGAAATCCGCCGCTGCTGGTAG
CCTCGTCCGAGCATATCTATCAGACTGCCGCTCTAGGTCGCTATTGGAAGCCGTTTTCGACCTTGTCCACTGCGTCCAAC
TCGACCACCCTCCACCGCCTCGATCTCCTCTTCCAATTCTACCACGACCAGATCGAACAGCGCCGCTGGTATGGCTTCTG
GGACCACGGCGACATCATGCATACCTACGACGGCGACCGCCACGGTTGGCGCTACGACGTCGGCGGCTATGCCTGGGACA
ACTCGGAGCTCTCGCCCGACCTCTGGCTGTGGCTCTTCTTTCTCTGCACCGGCCGTGCCGATAGTATTCCGTTGCGCCGA
GGCCCTGACCCGCCACACGAGTGAGGTTGACGCCTACCATCTCGGGCCCTTCCGCGGCCTCGGCTCCCGTCACGGCGTCC
AGCACTGGAGTGACAGCTGCAAGCAGGCCCGGGTGTCCAATGCTCTGTACCGCCGCATATTTTACTATCTGACCGCCGAC
GAGCGTGTCGGCGACCTGCTGGACGAGGTTCTGGACGCCGAGTCGGCCTTTTTGGTCTTGGACCCCTACCGCAAGGTTCG
GCCTGATCGTGGCACCTATCGGCCGCAGCCCGACACCATCTCCATCTCGCTCGGCACTGACTGGTCTGCCATTGCGGCCG
CCTGGCTCATTGCTTGGGAGCGCCGTGGCCCGACTGCCAATGCGTTTCGGAATAAGCTCTTTCGCAGCATGCGTGGCATT
GCCCGGCTGCCCAATGGCTTTGTTGCCGGCTTTGCCCTCTACAACCCCTGCACTGGCGACATCAGCCCCGACAGCGCCCG
GGGCCCCGTCAACGTTTCTCATCTCTCGGCCATGTTTGGTCTTGTCGAGCTGTGTGCCGAGCTGGCTTATCTGACCGATG
AGACCGATTCAGTCGATCAGCCGGTCGATCCCTCCGAGCCGTCCGAGCCGTCCGAACCGGCCGAGCAGCGGTCCTTTTAC
CAGGCTTGGCTCGACTACTGCCGTTTCTACAACGCCCCCGCAGACGAGCAACTTGACCGATATGGCTCCACCTTTCCTAA
TTTGCAGCTGCGCCAAGGCCACTCACGCCTCACCGCTTATGCTGCCGCCCGTTTCGCCTCTCCGGACCTGGCAGCCCGTG
CCCGTCGCGAGTTTGCCACCGGCGACGGCTACGACCAGACCACACCCTGGACCGTCCGACCGGTCGATGCTTGCGAGAAC
TTCACGCCCGCATACGAGGCCCCTTGGGTGTCCACCAATATTACCGCCCTCTACGGCCTGGCTGCCATCCAAAACATGGC
CTGGCTGGCTGATGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62