GenePrediction:GLEAN_814 Details

Name: GLEAN_814
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:204052..205298 (+ strand)
Length: 1247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:204052..204234 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_132:204299..204857 (+ strand)
Length: 559
Type: CDS
Source: GLEAN
Position: GCSC_132:204928..205298 (+ strand)
Length: 371
>GLEAN_814 class=GenePrediction position=GCSC_132:204052..205298 (+ strand)
ATGGCTAAGGATCTGACCACTACCAAATTCGAGCCCATCTACCCCGAGGGTCTGGCGCTCGCTATGATGATAACGACCAT
CGTCATGACCATCGTTTCCAGCATTGTGGTCAGCTTGCGATTTTACGCGCGCATTAGTCGAAACGCGTTTTCTTTTGAAG
ATTGGCTGATGCTCGCTGGATGGGTGAGCCTTGCACATTTTCTAACTGTCAGACTGCTTCTGCGAGCAGCTATCTAATCA
TCTATAGCTGCTCAATCTTGCGCATAACGCGGCTGTCATTGTACTCGCATTTACCGGAGTCGGATCACCCGACGACATTA
TCACGATCGGCATGGCGCACAGAACCGGGCTATGGACGGTAATATGGCAGTTTATATACGTCTTGGATGGAGCCATCATC
AAATCGAGCATCATCTGGACGCTTATGCGGCTGGCCAAGAATCTGAACATCGTCTACACGAAAATCTTGTGGGTATTGTT
CATCTTCAGCTGGATTGTCTGGCAGATATCATGGCCCGTTGCGATCTTCCAGTGCAAGCCTGTGTCTGCAGCCTGGGGTC
GGCCGGGAGACTGTACCTCCGGCCAATCGGTCATCTTGAACGTGTCGTATTTTGTTTCAGTTTCCAACGTCTTCACCGAT
ATAAGCACGGCTCTGCTACCGCTATTCTTGCTTCGACACCTTCAGATGCCCAAGAGGATTAAATTTATAACCATTGGCAT
CCTGTCGCTAGGTGTCTTTGCGTCGGTGGCTACCATTATCCGCATAACCTACACCTGGGCCTATTCTGCGAAGCATGGCA
GATATTGTGAGTTTCAAATCCACTTGCCTACTAAATTGAGTACAGGAAAAGACAAGTTAACAGTTATGCGTTGCAGATGA
GATTGGCAAAATTGTCACCTTGACGGTGCTTGAGTGCGACTTGGGTATCATCGCCGGCTCTGCGCCTATGTTGCGAATTC
TTCTCCGAAACATTCTCCCATCGTATGGTTCGAGCCAAGAAACAGCTGCCAAATCCCGGGATATTAACTTGGTGACCATC
GGCGGCGTGAACAGCCGGCGCACCCACATGGCCGGTGCTCAGAGATTGAATGACTACCAGGAAAACCAGGCTGCGGACAA
GGACAGCAATGAGGATAGCGACTCGACGCGATGCATAATCCGCGTAACCCACGAGGTTGAACAAGACACCTCCTCTGTTC
AAGACGGGCAAATGAACCAGCAGTCTGTCGTCTTAAGCAGAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62