GenePrediction:GLEAN_8150 Details

Name: GLEAN_8150
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:717300..715299 (- strand)
Length: 2002
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:717300..717043 (- strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_113:716983..716426 (- strand)
Length: 558
Type: CDS
Source: GLEAN
Position: GCSC_113:716369..716282 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_113:716212..715299 (- strand)
Length: 914
>GLEAN_8150 class=GenePrediction position=GCSC_113:717300..715299 (- strand)
ATGGACGCAGCGAAAAGTGAACAGCGCCCGGCCTCGTCGTTGTCGTCATCATCTGCAGCATCGGATCCATTGTCCAAGAA
GGAGAGCCGTCAAGGAAGGCCGAGCTATGCAGGATCTGACCGGAACCACCTGCGAGGCCAGTCGACGCGGTCGGCGACTG
ATCGGACCAGCCTGGCGATCCATGGCGAGCCGGACCACGACTATGAGCAGATTGGGGCCATTACGGCCGGCCATGAACTC
GATGTCGAGCTGGAGAATGTACGTGGAACGCTGCAGCGAACAGCGGAACACCAGATAGCTAACACTTGACAATACAGGCC
TACGACAGACAGGTGCTCGAGCGGATCGAGAGCCGCAGCAGCGTGGCGTACAGGCTGACGCAAGCGCTCAGCGCAGTCAG
CCGGGCGGACAAGCAGACGACCGAGAAGGATGGCCAGAAGACCAAATGGGCCGAGACGCTGCCGCTATCCGACCTTGACG
ACGGCGTCGTTGGCTGGGAGTCCGACGAGGACCCTATGCATCCGTGGAACTTTGACCCGACCAAGAAGTGGGTGCTGGTG
GCCTGCGTCTCGGGCGTGACCTTCTTGACGACCTTTACATCCTCGATCCTGTCGCCTGCCGTCGCCACTGTCGACCGCCA
GTTTGGCAACACCAGCACCATCATCTCTTCGCTCGTCGTCAGCGTCTATCTGCTCGGCTACGTGCTCGGGCCGCTCTTCA
TCGCTCCGCTGTCCGAGATCTACGGCCGCCTGCCCGTCCTGTTGACGGCTAACGTCATGTTCTGCTGCTGGCTGCTCGGC
TGCGCCCTGGCCCCTAATATGTCCGCCCTGATCGTCTTCCGCTTCCTTACCGGCGTTGGGGGTGCCGGCTGCATGGTGCG
TCGCTTTTTGTGTGACGTTTTACTTCTTTCTTCACCATACTAACTATCCAGACTCTTGGTGGAAGCATTATGGGTGACCT
CTTCCGCGCCGAACAGAGAGGCCTCGCTATGGGCATTTGGAACCTAGGACCACTAGTCGGTAGGTTTTGTTTACCGTCTG
CTGCTGCTACTACTACTACTACTAGTACAAGTGTCGCTAACCCTGCAGGCCCAACCATCGGTCCTCTTACCGGCGGCTTC
ATCGTCGAGAACATTGGCTGGCGCTGGGACTTTTGGATCTGCCTGATCGTCGCCGTTGCCTTTATCGGCACATTACAGAT
ATTCAATGTCGAGACTAACGCGCGTGTTATCATGCAGCGCAAGGTCGACCGCCTAAGCAAAGAGCTAAACCGCAGCGACC
TGCGCAGCTGCTACAGTAATGGGGCGGTCCTTAGTGGTTCTCGCATCCTGTTCAATAGCCTGGTGCGTCCGGTCAAGATG
CTGTTCCTGTCGCCGATGATCTTGTCTCTGTCGATGTACATCGCCTTTGTATACGGGGTCATGTACCTGCTCTTCACCAC
CATCCCGGGCGTGTTCGAGGTCACGTACGGCTTCAATGTCGGCCTAACCGGCCTCGTCTATCTTGCCCTCGGGATCAGTA
ACGTCGTCGGCTGGCTTGTTGTGGCCATCTACTCGGACAAATCGGTCATCAGCCTGACCAAGGCCAACGGCGGCAAGTTT
GAGCCCGAGATGCGCCTGGCCATCACCCCCTTCTTTGGCCTCTGCCTGCCCATCACCTTTTTCTGGTACGGCTGGACGGC
CCAGTACAAGGTCCACTGGATGTCACCCATCATGAGCCTGATGCCTTTTGGCTTCGGAATGATGGGCCTCTTCCTCCCCA
TCACGACCTATCTAGTGGATGCATACCCAATGTACGCCGCCTCGGCTCTGGCGGCCAATGTTGTGGCGCGAAGCCTCGTT
GGTGCCATGCTTCCCCTGGCCGGCCCGACCCTGTACGCCAATCTCAACTACGGCTGGGGCAACTCGGTGCTGGGCTTTAT
CTCCATCGCCATGGTCCCCGTGCCGCTGCTGATCACCAAGTTTGGCAAGCGGATGAGGACGTCGCAGAAGTTCCAGCTGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62