GenePrediction:GLEAN_8152 Details

Name: GLEAN_8152
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:706215..704509 (- strand)
Length: 1707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:706215..706096 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_113:706034..705982 (- strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_113:705915..704987 (- strand)
Length: 929
Type: CDS
Source: GLEAN
Position: GCSC_113:704928..704885 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_113:704826..704509 (- strand)
Length: 318
>GLEAN_8152 class=GenePrediction position=GCSC_113:706215..704509 (- strand)
ATGGTAACAGATATCAAGGGGGAAATCGTGGCTACACGCCCGGCTTCAGAGAGCGATGGCCCGGCAACGACGATCAGCCT
CGATCCTGTGAAGGAGGCAAAGATGATGCGCAAGTTCGACGTATGCCGGCCATTGACTTCTACTGCGCGATGTACACTTG
CTTACTTGCACTTTGAAACAGATCTGGGCGCTTGGTTCGTTGGGCATCCTCTACATGCTGGCCAATATCGATCGGTATGC
CTCTCTTATACCCACCCCAGCCAATGAAAAGCTATGAGCGTCATATCTAACTTCGGCCAGGAGCAACATTGGTAATGCTC
AGGTCTCCGGCCTGCCCGCCGATCTCGGCCTCATTGGCAACCAGTACGGCACGGCTGTGACACTCCTTTATGCCACCTAT
GTTCCCTTTGAGGGTCCGGTCGCCGTTCTTCTCAAGATCATCGGCCCCAAGTACCTGCTCTCGTGCTGCTGCCTCGCATG
GGGGGTTGTCTGTCTCTGTACTGGCTTCGTCCAGAACTGGCAGGGTCTGTATGCATGCCGCATGCTCACAGGCTTCTTCG
AGGCCGGTTTGATCCCTTGCATCAACGTCTACCTCAGCCTTATCTACAAGAAGGAGGAACGTGGCAAGCGGTCTTCTGTC
ATTTTTGCCTTCAGTGCTCTGGCCAGTGCCTTTGGCGGCCTGTTCGCCTACGGCCTGACCCATATCCACACGGGGACCGA
TTTCACGTCGTGGCGAGCCCTGTTTATGTTGGAAGGGGCTATCACGGTTCTTGTCGCACCATTTTTCTTTTACTTCTTCC
CTGACACGCCGCGGACCGCTTGGTTCTTGACGGAGGAGGAGAAGGGAATGATGGACCTCCGATATGAGCTCAATCCACAC
TGGGGCATTGACGAGAAGTTTACGTGGAAGGCCGTCCGCGATGCCCTGACTGATCCTAAGTGGTATGCATTTTGGATCTT
CCAGTTTAGCGTGGACATCTCCCTGTACGGCTTCACGACTTTCATGCCGACGATCATTAACGGCCTCGGCTACAAATCTT
ACAAAGCCAATCTTATGACCGTCCCCGTCTACTTTTGGGGACTCTTCACGTTTCTCTTTCTGGCATACATGTCGGACAGG
CAGCGTCTACGGGGCGCCTGGATTGCAGCCGCACTGCTATGCTTGATTGTTGGATACGCATTGCTGATAGGTGCAAAGAG
TCTTGGCGTTCGCTATTTTGCATGCTATAGTACGTGGATCTACATCTGTCTCTTGAGCCCCTGTCTTCTCGTACTGACGT
CATCCAGTCACCATTATGGGAATCTATCCGACGACTGGCCTCAGCATGATGGTATGTTTCTCACCACGATCGTGCAAGTC
TGACTGTCTAACCGTATCTCCTCTACCAGTGGCTCAGCGACAACTCGGCACAACACTTCAAGCGGGCAACCATGGTTGGT
GGTGCGCTGACGCTCGGCAACACGGCCGGCGTTGCAGTGGGCCAGATATTCGTGACTGCCGACAAGCCGCGGTACATCAA
GGGCTTGTCGATCGCGCTCGGCCTAGCCGTGGTGGCGCTCGTCTGTGTGACCTCGCTGGTGTATGGCATGAATGCAGCCA
ACAAGAGGCGTGCAGAGCGCATTCGGGTGGCAGAAGAGAATGGCGAGCCGTTGCCACATCAGCCGGAAATGGGCGACTAC
GACGTGCACTTCAGGTACACCTTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62