GenePrediction:GLEAN_8155 Details

Name: GLEAN_8155
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:689897..688403 (- strand)
Length: 1495
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:689897..689213 (- strand)
Length: 685
Type: CDS
Source: GLEAN
Position: GCSC_113:689148..688799 (- strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_113:688750..688403 (- strand)
Length: 348
>GLEAN_8155 class=GenePrediction position=GCSC_113:689897..688403 (- strand)
ATGCCTTCCTCCATCCCTTACGACCCGAGCCTTGTTCTGGCCAACATTGTCCACCCGGACAAGATTGCCAATCATCTTGC
CATGGCGCAGATCCAAGCCTCGGCGGACGAGCAACAGGATCATCTCAACGCCCTCATCGCCTCAAAGAGAAGCCTCGACA
TGACCAGGAGTCAACTCGTAAACATCAAAGTCGACACGAAGACCATTGATAGCAAGATGGAGGCCATGAATGCTGAAATC
GATAAAGTGGCGACTGGTTACTGCGCCGAGAGAATCAAGGCCGAGGAAGATCTCGTCAGTTGCCGAAAGAAGATGAGCGC
CGTTAACACCACTCCCGAGAGCCCTGTTGACTTCGTCAAGACGGATATCAAGACGATGCCCCTCGCCGCCGACTCACTCA
GTATGGATGTGCAGTACTTCTCCTTTGACATTAACATGCAAAGTTCCGATGAGCATGCCACTGCCGTCTCTGATGCGGTC
TGGGCTTCCGTCTCGAAGCTTGGCAACGACGCCGCGTATACGATGAGCCATGCCGTCCAGAGCCAGGTCTCGAAGCAAAC
GAGCGTGCACGATATCTCGGGAACCCTCGTCTTTACTGTTACGTGCACGCACAAGAACGCCTCCCTCCTCGCACCCCTTA
TCATCAACGTCGACAAGGGCATTGCGGCGTGGAACGAGCTGCACGGTAAAGACGAGCCGCTGGATCCGTCCAATCTCAAG
CAGCTTCAGGAGCTCTCCAAGAAAAAGAGAAATGACGAAGGAGATGCACATCGTCTCGGGCGTCACCTATGGCTCCAGCT
TTGTCGGCATGGTCCATGTCCTCAAGATGGAAAACACCTCCGCCTCTGAAAGCCTCAGCTCCATCGCCCAGACCCTCCAG
GCCCAGATGGACGCTGGCGCCTGGTTCGCAAAGGCCTCGGGTGGCTTCGGTGTCAACGACTCCTTCTCCAATGACGTCAA
GAACCTGCTCAGCTCCCAGAACGTCTCGTCCCATGTCACGGTAGTCAGTATGGGCGTCATCCCTTCCATCGTCGCCAACG
AGGTCAAGATCGGCGTCAAGGAGTTCGCCGACTTCGACCCTGCCAAGAACATGGCAGTCGTCGCCTCCATCCAAAACGCC
ACTGCTGCTGACCAGGACGCCGTCTAGTCTGCCGCCGATGGCGCCCGTACTGGTGCTCAGATCCAGAGTATGAAGTCCAC
TCAGATCAAGGCTGCCATTTCTGCCCTTGGAGACCTCCAGGACGGCGCCAACAAAATCATCGACATCAACTCCCTCATGA
CCGCCCTCGAGGACTACCTAAAGAAGGCCGCCGAGGGAAACTGTGGTGTCCCCATCAACTACTATCTCAAAATCCTTACC
CGCAAGATGCTCTGCCAGATGTGGGTGGCAAAGTACTACCCGGGCAAGTACCTCGAGATCAAGGCCGATGATAGTGAAAA
AATAAAATCCGGCAACGATGAGACTGTTCCGGCACCTAAGGAACCAAAGGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62