GenePrediction:GLEAN_8157 Details

Name: GLEAN_8157
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:676038..675432 (- strand)
Length: 607
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:676038..675804 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_113:675736..675432 (- strand)
Length: 305
>GLEAN_8157 class=GenePrediction position=GCSC_113:676038..675432 (- strand)
ATGGGACCTGGTCTTGAGATGTCTATCCCAGGCTATCGCGACAGCAGCAGGATAATCTGGGACCAGCAGACCGTAGTGAA
TAGACTATGGGAGCGCTGTGCGCTGAGCGCGGGATTACGAGAGCTTTTGGCCACCTGTCCTGGAGAGAGGTACGACGGCC
CAGGACACTGGGAGTTTAGCAGGCTCAATGACCGCATGCGCTTTCTTAAGTACACCAAAGGGCAGTTTTTCCTTCGTAAG
TCTGGCCTCGCACCAAAAACTCGGGTCCCATTGGTTATCGTATCTAACTTTTGCAAATCCAGCACATACCGACAGTCCCT
ATTATTATGAGGCAAACGGGGAGAAATTCCTGACGTTTTACACCGTGCACCTTTACTTAAATGACTCGTTTGAGGTGGAT
CCCACGTCGAAGCTTGTTGGTGGAACCACGTCGTTTCTGTCAAAGGACAAGTCGAAGCGAGCAGATGTCAATCCAAAGGC
TGGCAGCGTACTGATTTTTCAACATAAAGGACTGTATCACGAGGGGGCAAAAGTGATTGACGGGATAAAATATACTATGA
GAACTGATATCCTCTACCAATGGGTCCCAGCTCCAAAGAATGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62