GenePrediction:GLEAN_8158 Details

Name: GLEAN_8158
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:674973..673029 (- strand)
Length: 1945
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:674973..674535 (- strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_113:674448..674355 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_113:674007..673854 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_113:673812..673699 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_113:673624..673527 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_113:673364..673236 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:673134..673029 (- strand)
Length: 106
>GLEAN_8158 class=GenePrediction position=GCSC_113:674973..673029 (- strand)
ATGCCTGTTGTGGGGGTGTGGAGGTCACCACAGATGAGGCAGAGACAGCAGGCCCTTAGTGAGAGACCAGTGCAGTTTGA
CGGCCTTGTTAGCTCAGTCGAAGCCAGCTGCCAGCTGTACGTCTCGAAGCAGAGCGACGTGGATGGCTGGGCCTTGTCTG
CAGTCGTGTTTTGGCTGATGACCAGTGACAGGTGGACGTCCTCGGACTCGACCTGCTCTTTGGAGTCAGCACAGTTTTGG
CCGCCCATCTTCTGCCGGGTCTCAGGACGTCGCGGCGTTCTCGGCAAGATCAACGGCACCATGGACCCGTACGAAAAGAA
TGAGGTCAAGCGCTTCCCTCTGTTTGCCGGTGTCCAAAGAAATCCCCATAGATATCAACAATGCACCGCCAGAACAGGCG
CCACCACTTCCGAGTCTGGAAACGCCATGTCCATTCTGTGTTTCCCGACTTGATGGTCTTGGAGCCCAGTCTGCAGGTGT
TCCAGAAGTACTTACACTTCAGAACTAAACAAATCGGCTCGACAGACGCCTTGCTCATATTGGACAGCTGCGGTACCGAT
ATCTCGGCATTTGCATGCGTCACTATAAGAAACGACGGCTCGCGCTTCACGCCTGACTTGTTCTGATTATTAATGACGCC
AAACGGTTGGATTCAGTTACAGCTGAGCTCGTCTGACTTTGTGGCCAACATTCTGCAGGTCTTTTCCAGAGTTAGACTCT
ACTTTCGGACCGGGCTGTCCATCATCACTGACTCGATCTACTCTGACAGCAGCACACAGACTCTCGGACTGTACATCAAG
AGTTGCACACCTTTTAGCATCGGTACAGCAGCAACTGTCCCGCTTCAAAACCCTGACTCTTCATCTCCGAGAATGGTCCT
GTCAACCGTTTTTGAATACACCGGCCCCAAAACGGCATCGCCCGGTTGGCCTCCGTTAAGACCACGCACGTCTCGCTTCC
AACCAGTGCCGACGTCCCCATTGTCCTAGGCCCCGACCAACGGACGTGGGCATCGTCCCCATGGAACCTGCCCGACGCCT
CGACGGCTCCGTTGGCCAGGAATATCCACGTCTACTTTGCCGACAACGGGCTACATCTATGCTGGGACGTCGTTAACACC
GTGGCCTCCTGTTGCATCCATATCTACTGCCCGGCCACCAGTGCGTCGTAGTCGGCCGGGACCTGCCCGAGTCTGAGATA
GCCGGTCGCTATGTTTTGCCGCTCTACATCGACCAGCTCGACGTCCTCCACATCAACGGCAGGGCCAAGGTCTGGGTCTG
CTGTACCACAACCGCCGGCAGTCTCTACAAGGTCAAAGAGAACACCATCTGGCTGTCCCGGCTTGACAGTTCGGCCTCTC
CGAAAAACGCGCCAATACGACAACAGCTGCGTCGGCGTCGTTGTTGTCCAGCATAGCCGTCTGGAACGGTGATCTCGACA
CCATCAGGTAGCTCGGTCATGACGTCGCCACAGTCCAGGGCAATCTGCTGCCGGACCGGTCCGACATCTTGACAGTGACG
CAGAACGCCGACGCAGACTCGGTGTTGTGACGACTGGCCGTCTGTTTGGCCAAAGACGTCGGGCTAATCTTGCTGCAGCC
TAACAACAGCACCATAACCCTGGGCAACCGCTGCTGTGCCGACACCAACTCGTCGTCGCCTACGTACTACGCGCAGGTCG
TTACCGACAGCAGCAACCCGTCACCCAACAACCAGCCGCCGGCCTGGTACTCGACAGCGTACGTCACCAAGGTGGATTAG
ATCACGGCCGATAATGGCGTGCAGATGGCGAAGCAAATGCCCAACATCAATAGTGGGGTGGACCAGCCGTCTTGGACAGT
GGCCTGGACCGTGGCACCACCACGGACAGCCTCAACACGGTCGACTCTGTGCCGGGACATGTGGTCCAATTTCAAGCCAC
CAAATTTGTACTGATCCAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62