GenePrediction:GLEAN_815 Details

Name: GLEAN_815
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:209237..211864 (+ strand)
Length: 2628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:209237..209519 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_132:209581..210730 (+ strand)
Length: 1150
Type: CDS
Source: GLEAN
Position: GCSC_132:210967..211864 (+ strand)
Length: 898
>GLEAN_815 class=GenePrediction position=GCSC_132:209237..211864 (+ strand)
ATGGGGCTCAAGACTTCGGCACGGAAGAGAAAGGCACAGGTACAGGGCCGGCCTGATGCGCGGCCTTCCAAGACGGCGCG
GCCCATCTCACCGCCCAGCGACGAGCCGTTTGAGCCGCGGAGCTTACAAACTGTCGTGTCCACCGAAGAGCTTGAGATCA
CAGTCGACACGCTGAAAACGCTGTCGTCCTATCCGGGTCTGATTAAGTCGAGGCCATGCCGGCATCTGCGGGTGGCTGCA
CACGAGTTCCGGCAGGCCTGCACGACGGGCGTCAATGCTGCCGGTGCGTGTTCTTTATCGAAACTGATTCCAAAGATGAC
TGGATTTCTGACAAATGTGTGCAGGCATGAACCTGACGGCCAGGATTACTGGTGCTCTTGCAGACGGAAAATTCCTCGAA
GCGCGTGTGCTGCTGGCCGAGATGCGAATCCGCGGCGAGGAGCCCAAGCTAGGGGCCTTGTGTCGGTGGGTGCGAGATCT
GGACATTGTCAGTGGTCTGTCGACGCTGCCGGCCAGCAGTCGAGCCGCGGTAGAGCGCGCCGGTGAGGAGAAGGAGCGCC
TGCTCGTTGTCGATGCCGTCCTTCGCACCATTGGTCCCGTCGACGCAAACTTGGACGCTGTGCGACAGTCGGCCAACTCG
CCGTCCATCAACGTGCAGAAGATGTGGGATCTCCGGCAGTCGACGACGGCCGACCAGGTCTACGACTCTGTTTTGGACAA
GTCTATTCTCAAGCTGGCACCGAGCAACCCGGCCACAGCCCTGCCCATCATCGAGACCACCGACGGCCTTCAGCGTAAGC
CGCCAAACCACCATCCAGCCATCGTCTACACGTCTGCCCCGAATGCCATGTCCTTGTCGCCGAAATCGCCGACCATCACG
TACCAGGCCCATCCCGTCGTGCCTGGCCTGGGCGTGGCCACTGACGTGCTCTCGCCCGACGAATGCAAGGCCATCATTGC
CGCCGGCGAGAGCGTCGGCTTCCTGCCCGACTCGCCGATTCGAGAGGATGGTGACGTCAGCATCTTGGCGCACAACTTCT
ACTGGGTCGTTGACAACGCGTTTCACGATACGCTCTGGGCACGGATATCGCCATATGTGCCCGCTGCCATGGACGGCCGC
GTGGCCCGTGGGATCAACCGCCGCTTCCGCGTATATCGCTACGTGCCTGGCGCAGAGTACCGCAGCCATATTGACGGGGC
CTGGCCGCCTTCGGGGATCCTTGCTGACCAGACTTACGTGTACGATGCGTCGCCCGAGGGAAAGAAGCAGAGCTCCCTCT
TTACGTTCTTGGTGTACCTGAACGATGAGTTTGAGGGTGGCGAGACAACATTCTTCTTGCCGGCAGCGCTGGAAGGAACG
CTCAATGCATACCCGGTCCGGCCTGTGATGGGTGGTGTGGCCATTTTTCCGCATGGCCAGACACATGGAGCGCTGCTGCA
CGAGGGAACAGGAGTGAGGAAGGGTGCCAAGTATGTCATCCGGACGGATGTAGAGTACGATGTTGAGCCAACAACAAATT
AGGCGAATTGCCGCCAGAAATGCAAAGAGAAAAAGATCATGACATGATATTGTGTGATTTCATTTCGTCTTGCCAACTAC
CTTCTCCAGCTCGGATAATGGACTACGCTATCTGTGCAGCTATTCCGAATCGAGTCCAACTAGGCTAATTGCATCGATTT
ACGGCCATTGTCGCCGGATTTTCCAAAGAGACGTCTTCCTCTTCCAACAGGTGCACCTACTCCGCACATAGCAGCTTTCA
GCGGTCTGCCACCATGTCTGACGTCTCCGACCTCGCGGCTCTGATCGCCACGCGCTACGGCTCCACCACAACGACCGCGA
GTGCCACCACGCTCGATGGCCTGCCGGACAGCCCCGCCTTAAAGACGCTGCTGGGCCACAAGTCGGTGCGGTACTACCAG
GCGGACACGCCGTTGCCGGCAGGCGCGCTGGACGTGATCATCGCCGCAGCCCAAAGCGCACCGTCGTCGTGCAACTTGCA
GACCTGGAGCGTTGTCGCGGTGGCCGACCCCGAGCGCAAGGCCCAGCTGGCCACCCTGAGCGCAGACCAGTACTTTATCC
GGCAGGCGCCGCTCTTCCTCGTCTTCGTGGCCGATCTGCACCGCCTGGGTGCTGTCGCAGCCTCGGAGCAGCAGCCACCC
GGAGCCTCGCTCGCCTACACGGAGATGTTCCTGATGGCGTCCCTGGATGCCGCCTTTGCAGCCCAAAATGCGCTCGTCGC
TGCCGAGGCGCTCGGTCTCGGTGGCTGCTACGTCGGCGCTGCTCGCAACCGACCGCGTGAGGTGGCCGCTCTTCTCGGCC
TGCCCGACCGTGCCGTCGGCATCTTTGGCCTCGCTCTCGGCGTCCCCCGGCCTGACAGCACCATCGAGGTCAAGCCGCGG
CTGCCGGCCGCCGAGGTGCTCCATCACGAGCGTTGGGACGACGGGAACCAGGCAAGCCACCTGGCAACGTACAACGACGC
GATAGCCGCCTTCAACGGCCGCCAAAACCGCGTCCACAAGCCCGTCTGGACGGCCCAGTCGACCCTGCGCACGGCCACCG
AGGAGGGCATGGAAGGCCGGCACGAGCTACGACCGGTGCTGCACGAGCGCGGCTTCGAGTTGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62