GenePrediction:GLEAN_8160 Details

Name: GLEAN_8160
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:652235..649880 (- strand)
Length: 2356
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:652235..652018 (- strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_113:651952..651172 (- strand)
Length: 781
Type: CDS
Source: GLEAN
Position: GCSC_113:651112..649880 (- strand)
Length: 1233
>GLEAN_8160 class=GenePrediction position=GCSC_113:652235..649880 (- strand)
ATGTCGGGGTTTTCAAGCAGCAATTCCAGTACCGCCGGCGGTACGGGTGGTGCACCGACGGTAGCCCGTTCACGACGCAG
CAGTGCGGCCTGTCGACGGTGCCACACGCACAAGATCAAGTGCTCGGGCGGCACGCCGTGCCGAGGATGCATACGGTCAA
GGAAGGCCGACGAGTGTGTGTATCCACGAAAGGAGAAGAAGGTGACGGTGTCGGAAAGGTAGCCAGACCCTGAAGCGGAG
GCGTGGATTGCTTGGTCGACTGACAACTCGCACGTCGTTCCAGCTTTATCAAGAATCTCGAGGCCGAACGGGAGCGGCTG
AAGCGGGCGATAGAGAAGCCACAGCTTGGCTCAGCGTATGAGGACGGAGAGGACGACGCGGCCATGGCGGCCGAGGTGGC
CAACCCAGTGATGGAGCAGCGGGCCGAGTTTGCCTCGGCGCCGAAGCCGGTGTATGTCGGCGCAGCAGCCTGCACAGCCT
TTGCCGATCTTGTCTGGCACCACGTTCAGACGTCATCAGGCAGTAGCCAGTCGGCTGTGTGTGCATCTACGTCCACATGC
ACGAACACGACTTCGTCGCCATCCTCTCCCGCTCCCTCAGCCCCCCGACAGGTGGCCGTGTTCAACCATCCGACGCTGCG
GCGAGCGATGATCGATGGTTGTCATGAGTTCCGGACTGGATCTGGAGCGGCGCCAGCTCTAGCACTACCGAGCCAGTCCT
ACGCCACTCTGCTGGCGCAGGTTGTACTAAAGTTCGTCGGCCAGGACTACCACCTGGTGAGGAAGCGGTCGTTTCTCGAA
AAGGTTGACCAGGTGTACGCACGCAGCGCCAGATCTGGTGTCAGCTACGATGGCACGCCCTCAGCCGCGCCGCCCGACCG
CCGGTTTCTGTGCCGCATGTTCATCACCTTTGCACTCGGCGAGCTGTACCTGCGCAAGTCGGCCGTGACGACGGACGGGC
AGCAGGCCATCCCGGGCACGCACTTTTACCTGCAGGCAGTCGAGCTGTTCGAGGAGCACTATGAGGACCCGGACATTGAG
TACATTGAGACGTTGTTGCTCATGGTCTGTTGCTTCGCTGGTGTTGGCAGTCGTTTGTCGGATTGTCTTATGCTGACTAA
TAGTCCTTTTATTCGCACGCGCTCAACCGCAAGAACAGCGCGTACAACTACGCAGGCATGGCGCTGCGGCTCAGCGTCGC
ACTGGGACTGCATCGCAACATGACGTACGGAGCAGAGACGCCGGCGGTGGAGATTGAGAACCGGCGGCGAGTCTGGTGGA
CAGTCTACATGTTTGACCGGCTCTGCAGCTCGAAGCTAGGCCATCCGGTGATGATCAAGGACGCCGACATTGACGCGCCG
CTGCCATCAATGGACGGGCTGACGGCCGACGAGCGCGACGACTTCTTCGACGCAGCCCACCTGGTGGCCAACATTGGGCT
CGCCCGCATCACCGGTCGACTGTTAGATCTCGCCTACAAGATCCACCGGCCGCATGAGCGCACGTTCATCCGCGATATCC
ACCAAATCCTGACCAGCCTCAAGGAGTGGGAGGCGTCGCTGCCGGCCGACCTGCGTCCAGGCCCGACCAAGACGCCATCG
TACGTGTCGCGGCCGGTGGCGTCGCTGCGGCTGCACTTCAACCAGTGTGTCATCCTGACGACGCGACCGGTCCTCCTCTT
TGTCTTTAGGGGCTACGTGCGACAGCAGACACCCTCGGCCTCGCCCACGGTCATGGCCCTCAGCGAGGCCTGCATCGTGG
CCGCCCGGGCATCCCACCGGCTGCTCAAGCAGCTCTGGATGGATGGGGCCATCGCCACGTTTGGCTACTTTGACGCCCAC
TACATCTTCTCGTCCACGCTCGTGCTCGTGCTCGCCAGCCTGCTCAACCGTCACAGCTCGGCCGATCGCGACGCCGTCGG
GCTCTCCTTGCAGCTGCTTCAGTCCATGGCCGACGACGGGAACCTGCCGGCTCGCGAACTTCTCGACCGCCTCGTCTCCC
TGCAGCGCAACCTCGCCGCCAGCGTGCATCCCCTAGCCGCTGCCACGGCCGACCTCGACCATCCCCACGTCCTGCTCGGC
CCATCACCATCGTCGTCGTCTCCCTCGGCTGTCTTCCGTGCGGCCGAGAGCACGGTGACACCTCAGCAGCCTCTGCCGTC
TACGTCCAGCCCTCCGGGCGAGTCACCCTCGTCATCCACGGCCCCAACCATGATTCTCGAAGACCCTTTCCTCCGGCAGT
TTCTCGGGCTGCCCTACTCAGAACGCAGTCCTTCAGCTCTGGGCATGACCAACGACGAGATTTTTGGGATCTCGTCGCTC
GCCTGGGACATTGAAACGTTGGCAAAAGAGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62