GenePrediction:GLEAN_8161 Details

Name: GLEAN_8161
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:640602..637219 (- strand)
Length: 3384
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:640602..639994 (- strand)
Length: 609
Type: CDS
Source: GLEAN
Position: GCSC_113:639922..639292 (- strand)
Length: 631
Type: CDS
Source: GLEAN
Position: GCSC_113:639083..637219 (- strand)
Length: 1865
>GLEAN_8161 class=GenePrediction position=GCSC_113:640602..637219 (- strand)
ATGACCACAGCGGTATCTTCCAGCGCCGAGGCTGCTGTTTCGTCGCCGCCTCGGGGAAAGCTCTACGGCACCATGTCGCG
ATCCCAATCTACCCGATCTCGTCCAGCCTCTTCGCAGTCCAACAGCGCGCCTGCTCGTGCTGCCTCCCAGCATCATCACA
CATCGTCTCATCACTATGCCTCGGGTAACGGAAATGGAAACGGAAATGGCTACGATCCCGATACCACGGGTCACCATCGC
CGCAGCTCCAGCCGAGAAGTCCGATATGCGCCTCCATCAAACGCCGCGGACTCTTCGTCACGCCCGCATCGGCACGGCAG
CCAACGCTCTTCGCGACAGGCCTCCTCCCAAGTGCCTCCCCCACCGCAGCCACCATCGGCTGAAATGACGCAGCCGTCCG
CTGGCGTGTCCAGTGCCCAGAACAACGGCAGCAGCCATCACGCCCAACCCCAGGGAAAAACTGAGACCAAGCCGTCGGGG
AGCTCGCGTCAAAGCAAGCCGCGCACCACAGTTCCCGCACCTTCGGGTAAATGGATCCTTGGCAAGGTCATTGGTGCGGG
CAGCATGGGCAAAGTGCGTTTGGCAACTAAAGAAGACAGCAACGAAGTGGTACGCTTTCCGTCTTGGCCTGACATAGGCC
CCTTCCCCAATGCCTTTTTTTTCTAACTCGGTGTTTGTAGGTCGCATGCAAAATCATTCCAAGAGGCTCCACTGATGATG
GCCATCTTTCGCGCGCCGAGAAAGAGCGGGCAGACCAGTCCAAGGAAATCAGAACTGCCAGAGAGGCGGCCATCGTCACT
CTCCTAGACCATCCCTACATATGCGGCCTTCGTGATGTCGTACGCACCAACCACCACTGGTACATGCTGTTCGAATATGT
CAACGGCGGCCAAATGCTGGACTACATCATTGCGCATGGCAAGTTGAAAGAAAAGCCGGCTCGCAAGTTCAGTCGCCAGA
TCGCCAGTGCGCTGGACTACTGCCATCGCAACAGTATCGTCCACCGGGACCTCAAGATCGAAAACATCTTGATCAGTAAA
ACAGGGGACATTAAAATCATCGACTTCGGTTTGAGCAACCTGTTTTCCCCTCGCAGCCACTTAAAAACCTTCTGTGGTAG
TCTGTACTTTGCCGCTCCCGAACTCCTGCAAGCCAGAGCCTACACTGGCCCAGAGGTCGACATCTGGAGTTTTGGCATCG
TCCTGTACGTCCTTGTGTGTGGCAAGGTGCCATTTGACGACCAGAGCATCCCTGCTTTGCACTCCAAGATTAAAAAGGGC
TTAGTCGACTACCCTAACTGGCTGTCAGCTGGTGAGCTACTCTGTCTGTTTCCAAGTCACGTTTGTCTGTTTCTAATGCG
ATCTGTGACTTTTAGAATGCAAGCACCTTCTTTCTCGGATGCTGGTCACTGATCCGCGATCGCGAGCAACAATGCATGAG
GTCATGAATCATGTCTGGATGACAAAGGGTTACAGCGGGCCCCCTGATAACTATCTGCCGCGCCGGGATCCGCTTACAGC
TCCGCTCGACCAGGCTGTAATCAATGACATGACCGGCTTCAACTTTGGCGCTCCGACCTTGATCAAGGACCAACTGACCC
GCGTTATCGACTCTGAGGAGTACCAGCGTAATGTTCGACTACTTCAAAAGGAAAAGGAGCTCCTTCAGACACCCAAAGAT
GCAGAGCGAAAGAGAGGCTTCAATCTCGACTTCTATAAGCGACGCAATTCTGCCAACAGCCGAGATGCCCTGACCACGCC
CAGTGCTGAAGGACTGCCTCTTGGGAATGACCCCCTGAATGCCTTTAGCCCTCTGATCTCTATCTACTATCTGGCCCGCG
AGAAGAGAGAACGGGACCAGCTGGAACTCCAAGCTTCTATGCCTCCAGCGAAGGAGAAGGTCTCCTCCGTTCCTGAGATC
GCACCGCCTCAGGAAGCACACGTCAACACCAACTCGTACGAAATGCCAGGCGAGAAGACGACTGGCGGGCGAACACGGCC
CCGCTCACGAACCCACGGGGAGGATGAGATTCAAGAAGCCAAGGGCAAAGCTGCTGCTGCTGCTGCCGGGACCGGAGTGC
TACTATCGCCGGCATTGCCACCAGAGCCCCATCTGGACGTGCCAAAGAAAGAAAGTGCGGCAGCCGGTATTCTGCGTCGT
TTCAGCACTCGACGGCGCCCGAAGGACGTTGAGCGGCTTGACAAAGACCGCTCACACCCCCCCGTTGTCCACGTTCACTC
GCCAGCCGAGCAGAGCCAGCAAAGCCAACAGAGCAGCCAACAAATTCCGACGATACCTCGCAAGAGCTTCAGCATCCGGC
GCACCCGCCAAGACAATGACGAAGTGTCTGTGCCCCGGTGGCGGTCTGGCAGCAGCCAACCGCAACACAGTGATCTTCTC
AGCCCACCATTGTCTGCCAATGACGTGGATGGACACAAGAAGGGCCTTGACCGCTCGACCAGCGTTAGTTCAGCAGAGTA
CAGCCGGCGCCGGCCGATAGGAGGGTCCGCTAGTAGAATTGTGAAAGACATGCCCCAGACCAGTGGGTCCGATCACTCGG
CCGCGAACGAAAGAGGCCAAGGCGAACAGCAGCAAGCCGGCCGTATCGGCGGCCGCTCTGTGTCTCTACGGGCGAAGCCG
CTCGGACATGCTCGGAGAGAGAGCATCCAGGCTCGGCGACTTCGCCTGGAAGAAGAGCGCAGTCGGGAAGCGAACGTCCC
AGAAGAGGCAGACGCCGATCTTGGCGAGCAAAGCGGAGTCTCCAATGAGCGACTCACAGACTTTGACCTCGACAAGCCAG
TGTATCTCAAAGGACTGTTCAGTGTGTCGACCACGTCGACAAAACCTGTGCGCGAGATTCGCGCAGACATCAAGAGGGTG
CTGAAGCAGCTAGGCGTGGACTACGTCGAAATTAAGGGCGGCTTCAGTTGTCGCCACTCGCCAAGCATCGATCTCAACAA
GGTTACTGATGGGCCTAGCAGTCCACCGGCGAATTCAGGTCACAGAGGGCGGTTTAGTTTCAGCGCTCTGCGGCCGGGTG
AACGGGAACGTGTTGACGTTCGTGACAATCTGGAGAGAGGCCCGACCACCCCGCGGACTCCCGGAATGCCGGGCAGAAGT
GCAGAGTACTCCAACTCGGATGTCTCCGATGATAGTGAGCCCCGCGCGATCCGCGGTGACTCGGGCAGGCGGGTCATGGC
CGCAGGCGAGACGACAACTCATGTGCGCAGCGACATGGGAGGCAACCTTGTCTTGGAGTTTGAGATATTCATCGTCAAGG
TCCCCATGATCTCTATTCATGGCATCCAGTTCAAGCGGCTAAGCGGCAACACTTGGCAATACAAGAGCATGGCCGACCAC
ATTCTTCGCGAGCTGAGGCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62