GenePrediction:GLEAN_8162 Details

Name: GLEAN_8162
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:635324..634290 (- strand)
Length: 1035
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:635324..635210 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:635136..634981 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_113:634912..634537 (- strand)
Length: 376
Type: CDS
Source: GLEAN
Position: GCSC_113:634470..634290 (- strand)
Length: 181
>GLEAN_8162 class=GenePrediction position=GCSC_113:635324..634290 (- strand)
ATGGGCTACATTGCGGACCTGCTGAACGAAAACACGCGTGAGGCGGCCCTGCTTGAGCTGAGCAAGAAGCGGGAACAGGT
GCCGGAGCTGGCGCTTATCTTGTGGCATTCATTTGGTGGGTCCAATTCCATAATCAAAAGCCGGTCAACGAGATCAAAGG
ACACTTCATGCTGACCACGAATCTTTAGGTGTCATGACCTCGCTCCTTCAGGAGATCATCTCGGTCTACTCGCTACTCAA
TCCGTCACAGCTCACGGCGGCGGCCTCGAACCGGGTCTGCAACGCGCTGGCGCTTCTTCAGTGTGTGGCCTCGCATAACG
AGACGCGCACGCTCTTCCTCAGCGGTGAGCATTGACCCCTCCTTTTCGCAGCGTCTGCCGTAGCAGGACGGCCATGGCTG
ATTCGCTTCTAGCGCACATTCCCCTGTTCCTCTACCCGTTCCTCAACACGACGTCCAAGTCGCGGCCCTTTGAGTACCTG
CGGCTCACGTCGCTGGGCGTGATTGGTGCCCTGGTCAAGAACGACTCCTCCGAGGTGATCAACTTTCTCTTGACGACGGA
GATCATTCCGCTATGCCTGCGCATTATGGAGACGGGCTCTGAGCTGAGCAAGACGGTGGCCATCTTCATCGTGCAGAAGA
TCTTGCTGGACGACAATGGTCTGAACTACATCTGCGCCACCTACGAGCGGTTTTATGCTGTCGGCACCGTTCTTAGCAAC
ATGGTTGCACAGCTGGTCGAGCAGCAGACGGCCCGCCTCCTTAAGCATGTTGTGCGCTGCTTCTTGCGGTATGTCTTACT
GCATTGGTCCTGTCGTGCCGCTACCCTTGTGTACGCACGTTGCTAACATGACAGACTCTCTGACAACGCCCGCGCCCGTG
AGGCGCTTCGCCAGTGCCTCCCCGAACCTCTTCGCGACGCCACCTTCTCTTCAGTGCTGCGTGACGATGCGGCCACGAAG
CGCTGCCTGGCCCAGCTCCTCATCAACCTTTCTGACAACATCGTGGAGCCGGGAACGGGCCACCCGTCTATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62