GenePrediction:GLEAN_8163 Details

Name: GLEAN_8163
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:632047..629255 (- strand)
Length: 2793
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:632047..630788 (- strand)
Length: 1260
Type: CDS
Source: GLEAN
Position: GCSC_113:630718..629255 (- strand)
Length: 1464
>GLEAN_8163 class=GenePrediction position=GCSC_113:632047..629255 (- strand)
ATGGCGACGGCGACGGTGACGGCGACCGTCGTGTCGGCAGTCTTGACGACGGTCTCGGCCACCAAGTCCTCGGCCACGGC
CACGTCCACGACCCGCGCAAAAGCCCAGGGCGGCGTCCTGGACGGCCTCGACCCGATTGTATACGATGCTAGCAACCCGA
TCCTGCTCTTCATCGTGCAGGCCGTCATCATCATTGTGTTCTGTCGCCTGCTGCACTATCCGCTCCGTTATCTGGGCCAG
CCACGGGTCATCGCCGAGGTCATTGGCGGCATCCTGCTGGGCCCGTCCGTCATGATGCGCATCCCCGGCTTCAAGGCCAA
CATCTTCCCGACCGAGAGCATGCCGATCCTGAGCAACATTGCCAATCTGGGCCTGATCATCTTTCTCTTCCTCACCGGGC
TCGAGGTCGACCTGGGCATGTTCCGCCAGAACTGGCGGGCCGCCGTCGGGGTCTCGCTTGCGAGCATGGCCCTGCCCTTT
GGTCTCGGCTATGCCATCGCCTGGGGGCTGTACAAGCAGTTTGACGACGCGCAGAGCACCGAGCCGATCGGCTTCGGCGT
CTACGGCCTCTTCATCGGCACCGCCCTCGCCATCACCGCCTTCCCGGTGCTCTGCCGCATCCTGACCGAGCTGAAGCTGC
TTAACAACATTGTCGGCGTGACCGCGCTGGCGGCCGGCGTCGGTAACGACGTCGTCGGCTGGATCCTGCTGGCGCTGTGC
GTCTCGCTCGTCAACAACAGCAGCGGCCTGACCGCCCTCTGGGCTCTCCTCTGCGTCTTCGGCTGGACGCTTTTCCTCGT
CTTCGGCGTCCGGCCCTGCTTCATCTGGGTTCTGCGTCGCAACGGAAGCCTGCAGAATGGCCCCACCGAATCCATGGTCT
GCCTGACCCTTCTGCTCGTCCTCACGTCGGCCTGGTTTACCGGCATCATTGGCATCCATCCCATCTTTGGTGGTTTCCTT
GTCGGTGTCATTTGTCCACACGACGGAGGTTTCACCGTCAAATTGACGGAAAAAATTGAAGACTTCCTTTCCGGCCTCTT
TCTGCCCCTCTACTTTGCCCTTTCTGGGCTCAGCACGAATCTTGGCCTGCTCAACAACGGCATCACCTGGGCTTATGTAA
TTGGTATCATTTCCGTCGCCTTCGTCGGCAAGTTTGTCGGTGGTACTCTCTCTGCCCGCCTCTGTGGCATGTTCTGGCGA
GAAAGCTGCAGCGTTGGGGTTCTTATGAGCTGCAAGGGTCTTGTCGAATTGATTGTGCTGGTGAGTAACGTCGAGCTTCC
TGTCTGTGTTGTTTCTGTTTAGTCCTCGAGCTCTGCTAACCTCGTACAGAATATTGGACTTCAAGCAAAGATTATCTCGC
AGCGAACCTTTACTATGTTTGTCGTTATGGCACTCATCACAACTGTGTCGACGACTCCTCTGACCAGACTCGTCTACCCT
CTGTCTTACCGGCAAAAGTGTGAGAAATTTCGACGTGGCGAAATCGACTGGGAGGGAAATCCCATCAACAGCGAGGACGA
CAGCCAGCGGGAGTCTCTCGACAAGCTCAAGCAGACCCAAGTTCGTCGCCTGCTCGTCTACCTGCGTCTGGATAGTCTCC
CTGGTCTCTTTACGTTCATCTCTATTCTGGGGAACATTGACGGACCGAATAGCAAAGCAGCTGAAGACGGCAAAATGCAG
ACGGAAACGGCTCCACGCCGGCATCTGCAAGTTCATGGTATTCGGCTGCTGGAGCTGACTGAGCGGACGTCTTCGGTTAT
GCAAGTTACCGAAGTGAATGAATTTACCCGCCATGACCCTGTTGTCAATACGTTTCGGACCTTCTCTCAACTGCATGACT
TGGCGGTTTCGGGTCAAGTAGCTGTCTCGCCAGCTGCTTCATTCCCGGAGACACTGGTAACGGAAGCAACCGAGATGGAA
TCGGACTTCGTGCTGATCCCATGGGGCGAAAGGGGGCTTGTCAGTGACGAGTCGTCGGCTCTGTTCACGATGAGCTCGTC
AACTACTCGCTTCGACGACCGTGCCCACCTCGACTTCCTCCATGCAGCTATGGACAAGGCCGTGTGCAACACGGGTATTT
TCATCGACAACGGATTTGGCACTGCCTCTGGCTCCCGCCATGAACAGCCCAGTCTCACACGCACAGTATCACTCTTGTCA
ATGCGTAGCCATCGCGAGCCGGCGACTCTGCCCGTAGCGAACAAGACTCATCGGATATTCTTTCCTTTCTTCGGTGGTGT
GGACGATCGGGTCGCTCTCCGAGTCGTTCTGCAGCTGGCCAAGAACACAAACATATCGCTTACCATTGCTATGTTCAACA
CGGACGGGGAGGGCGCAGTAGGCAGCCATGGACCCGAAGTGGTGGGGGCCAGTCTCAGTGCCAGCATCTCTGCGGACGAA
CCGATGTCAAAATCGAAGGCGATGGCTGTTCAGGACGAGTTGTCTGCACATGATCTTGGTCTGTTATCAATGCTTCAGTC
ATCCCTTCCCAGCGAGCTGTCTGGGCGGGTCAAGTTTGTGGACGTTTCTGTCAACGGGTCCGCTTCGGTTTTGCTGGACG
AGGCGATGGTGCGTGCCGGCCAGGTGGTGGGACAAGGACCGCGCAATGGTGGTGACATTGTTGTTCTCGGTCGTCACCAC
GCACGTTTTGGCGATGCTCCTGTGGCGGCCGAGTCGTCGTCCGGCTACGATTTGGCCCGAACAATTGGGACGGCGGGGGC
TCGGGTGGTGGATGCGAAGCTCAAAGCTAGCGTGCTGGTCATCCAAGCAGGTGGCCTTGGATTGGAGTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62