GenePrediction:GLEAN_8164 Details

Name: GLEAN_8164
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:628355..624765 (- strand)
Length: 3591
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:628355..628291 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_113:628231..628081 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_113:628009..626091 (- strand)
Length: 1919
Type: CDS
Source: GLEAN
Position: GCSC_113:625941..624765 (- strand)
Length: 1177
>GLEAN_8164 class=GenePrediction position=GCSC_113:628355..624765 (- strand)
ATGGCTACAAATACGAGGAAGAAGGTGGTTGTCGTGGGGCTAGGAATGGTGGGCATCAGCTTCATGTAAGTGGACGATCA
TTGTGTCAGCACGGGTTAACAATGGGCTTCTAACGAGACGACAGAGAGAAACTGCTGAAGCTTGACGCCAGAGCGCGAGA
TTACGACATTGTAGTGTTTGGCGAGGAGGAGCACCTGGCATATAATCGGGTGGGCCTGACGACATATTTCGGGCATCGAC
AAGCAGAGAAGCTGTACCTGAACCGACGAGATTGGGTATGATAGCAGCCAGCTGGAGCGGCTTTTGTTGAGTTGCAAGGT
ATGGGCTGACACATTCGCGGGAACAGTACGAAAGCATCGCAGACGGGGCGCTGCGGTACCACACGAGCAAGCGTGTAGCA
GCGATCGACACGGAGAGTAAGACGGTGATGTGCGAGGACGGAAGTGCAGAGGGATACGACATCTTGGTGCTGGCGACAGG
GTCGGATGCGGTGCTTCCTCGACAAACGCCGGGACACGACGCACAGGGAGTGTTTGTATACCGCAATATTGCCGACCTGG
AGAAGCTCATCAGGTATGAGAGCAGCGGCGTGGGAGCGGTAGTGGGCGGAGGGCTGTTGGGGCTGGAGGCAGCCAAGGCG
ATGATAGACTTGGGGCGGTTCGACAAGGTGGTGGTGATCGAGCGGAATAGCTGGGTTCTGAGCCGGCAGCTGGACGACGA
GGGAGGCGGGATGGTGGTGGAGAGTGTGCAGAAATTGGGAGTGGAGGTGCTTTTGCGCAAACGCGTGAAAATTGTGTTGA
CAGAGGGAATTGAAGGGGAAGGGGGAGAGTCGAAGCGGGTGATAGGCGTGCAGTTTGAAGATGGCGAGAAGCTGGCGCTG
TCGACGGTATGCTTTGCGATCGGGGTGCGACCACGAGACGAGCTGGCGCGAGCAGCTGGAATCGAATGCGCAGAACGAAG
CAGCGGTGGTGTGGTGGTGGGCGACGACCTGCAGACGAGTGCAGCAGATGTGTATGCGGTGGGAGAGTGTGCCAGTTGGC
ACGGGCAGACGTTTGGGCTGATCGGGCCGGGCGTGGAGATGGCGGATGTGCTGGCCTTCAACCTGACGCAGGCAAAGCTG
CACAAAGTGCGGAGCTTCAGGCGACCGGATCTGAGCACACGACTGAAGCTGTTGGGAGTCGAGGTGGCGAGCTTTGGCGA
CTTCTTTGCAGACCGAGACGGGCCGATGGGACTGCCGGCGAAGGCGAAGAGAGGCAAGGCCGGCGGGGAGGCCAGAGCAG
CAGCAGGAACGGCAGCGGTGAAAGCGCTGACATACAAGGATCCGTTTCGGGGCATCTACAAGAAGTACATCTTCACGGCA
GACGGTCGCTTTCTGCTGGGCGGAATGATGATTGGCGACACGAGTGACTACGTCCGGCTGGTGGCGATGGTGACGAAGCA
GAAGGAGCTGGACCGAGCGCCGGGCGAGCTGATCGTGGGAGCCAGAGCGAGCGATGAGGCCGGAGCGAACGAGCTGGACG
ACGAGACACAGATCTGCTCGTGCCACAACGTGAGCAAGGGCGCAGTGGTGGCGGCGGTGCGCGACGGCGGCTGCACGAGC
CTGGGGGCAGTCAAGGCGTGCACGAAGGCGGGCACGGGCTGCGGTGGGTGCGTGCCGCTGGTGACGAGCATCTTTCGGAC
GGCGATGGCGGCGCTGGGAAACGAGGTATCGCAGGATGTGTGCGCGCACTTCCGCCACAGTCGTGCGGACCTGTACCACA
TTGTGGCGGTGCGCGGTCTCAAGACGCTGGCCGAGGTGATGGCGGCAGCCGGGGTTCGGGCCGACAGTGTCGGCTGCGAG
GTGTGTCGGCCGGTGGTGGGCAGCATTCTGGCGAGCCAGTGGAACGGTCACGTGATGCGAGGACCAACCCAAGCGTTGCA
AGACACCAACGACCGCTGGCTCGGCAACATGCAGCGCGACGGGACGTTCAGCGTGGTGCCGCGGGTAGCCGCAGGCGAGA
TCACGCCGGCGCGGCTGGTCGTTCTCGGCGAGGTGGCCCGCGACTTTGGGCTGTATGCCAAGATTACGGGCGGCCAGCGG
ATCGACCTGTTTGGAGCGCGGCGGCCAGACCTGCCGGCGATCTGGCAGCGGCTCGTCGACGCCGGCATGGAGAGCGGTCA
CGCGTACGCCAAGAGCCTGCGGACGGTCAAGAGCTGCGTGGGCACGACGTGGTGTCGGTACGGCGTGGGCGATGCCGTCG
GCCTGGCTGTCCGGCTAGAGGAACGGTACAAGAGCATCCGAGGGCCACACAAGATCAAGGGGGGGGGTCGAGCGGCTGCG
TGCGGGAGTGTGCCGAAGCACAGAGCAAGGAGTAGGTGTTTTCTTTTGTGTTTTCTTTTGTTTGTGTAGAGGCAAAAATG
CTGACTAAGCACAGCTTCGGTCTCATCGCTACGGAAAAAGGCTTCAACATTTACGTCGGCGGCAACGGCGGGGCGACACC
GCGTCACGCCGAGCTGTTGGCCCGCGACGTGGCGCCGGCCGACGTGGTTCCGATCCTGGACCGGTACCTGGCGCTGTACA
TCCGGACGGCCGACCGGCTGCAGCGCACGGCACGCTGGATCGAGGCGTTGCCGGGCGGCGTGGCCTACCTGCGCGACGTG
ATCGTGCACGACCGGCTGGGCCTAGCGGCCGAGCTGGAGGCACAGATGGCCGAGCTGGTCGGGTCCTTCTTTGACGAGTG
GGCCGAGGCGCTACGGGATCCAGCGCTGCTGGCGCGATTCCGCCAGTTTGCCAACACGGAAGAGAGGCTGGCGGGCGAGG
CAGAGCGAGAGACGGAGCGCCAGCAAGAGCGGCCAGTGTTTGAGAAGAGGGGGATGGAGGTGGAGGTGGAGGTGGAGGTG
GATGGTGGGAGGGTCGAAAAGGACCCGAAAAAGGACCCAAGAAAGGACCCAAGAAAGGACCCAAGAAAGGGCCTAAAAGA
CCCGGAAAAGGACAGGGACTTTGCTGCGCTCACCAACAGCTGGTCCACCCTCGCATGGCAGCCGGTCCTCGACGTGGCCA
CATTCGATCGCCAGACCGGCACGGCCTCGACCTCCTCGACAACCGATGTGGCCGCCACGACCGTCAAGCTCGGCGACACC
CAGCTGGCCCTCTTCCGGGTGCGCGGCCACTACTACGCCACCCAGCAGATGTGTCCGCACAAGCGGGCGTTTGTCCTGTC
GGACGGGCTGATCGGCGACGACCCCACCGACCGCCAGCAGCCCTGGGTCTCGTGTCCGCTGCACAAGCGTAACTTTGACC
TCGGCTCGGGCGCCTGTCGCAGCGACCCGGCCAGCGGGCTCAGCCTGGCCACGTTTGCTGTCCGGGTGGAACCGGAACCG
AAACCGGAACAGGAGAAACAGACCATCGCCATCTGCCTGCCGCCACCAGCTGAGCTGGACGCTGCTCTCGGCACAGCCCG
CTGGCGACTGCGCGCCGGCGAGGCTGGCCCGCCACAGCTGGCCGAACTCGACCGCCGACTGCAGCCAAGTCTGGTCGGCC
GGCGGGCCAGCAAGACGATAGACCGACGGCCAGCTGCACCAATCACAGCAGGCGGCGGACTCGACTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62