GenePrediction:GLEAN_8165 Details

Name: GLEAN_8165
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:616636..613277 (- strand)
Length: 3360
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:616636..615283 (- strand)
Length: 1354
Type: CDS
Source: GLEAN
Position: GCSC_113:615222..613277 (- strand)
Length: 1946
>GLEAN_8165 class=GenePrediction position=GCSC_113:616636..613277 (- strand)
ATGGCTGCAGGAACGGCTGTTATCGACCTCTGCTCCGACTCGGACTCAGACTCAGGCTCGGACGGCTTTCCCAAGTCTCC
GGTCTACCATGGCGTGAAGGCTTTGCCAAAGCCAACGGTAAAAGCACCTCTAAGACGCGAGCAGAAGCCCAGGCCAGATG
TTCGCTCCCGGGCCCCGCCGGCTGCCCCCAAGCCGGCCCGCGTCAACAGCACCTCCATTCTGGACTCGCTCAATCCAGCA
CAGCGCCGTGCCGTCGTCTCGTCGGCCAACACGGTAGCCATCCTGGCCGGTCCCGGAAGCGGAAAGACGCACACGCTGAC
ATCGCGCGTGGTCTGGCTTGTCGACGCCCTCGGCTACCGGCCGCAGGACGTCATCGTGGCCACCTTTACCGTCAAGGCCG
CCCGCGAGATGAAGGAGCGTATCGGCAAGGTCCTGTGCGACGGCCGCGAGCGCAGAATCGTCCTCGGCACCTTTCACAGT
GTGGCCCGTCGATACTTGGCTACGTACGGCAAGCGGATCGGACTCAGCCAGAAGTTCAGCATCATCGATGACGCCGACTC
CAAGGCCATCCTCACCCGCATCATCAAGCGTCTGCAGGTCCAGCTGGACGCGGCCGGGGCGCGCTCTTGGATCAGCAAGA
AAAAGTCCAAGGGCAGCTTGACAGAGGAGGAGCCGGCCCCGAAGAAGCCGAGCTTCCCGTCGGCCGTGCCGCGCGTCGAT
CCCGTCAAGAACCTGGAAAAGGTCTACGGCGAATACCAGGCTCACCTGGACCAGCTGAACCTGCTCGACTACGACGACCT
GCTCGTCAAGTGCGCCGACCTTTTGCGGCTACACCCCGGCTGCGTGGCCAACGTGCAGGCCGTCCTGATCGACGAGTACC
AGGACACCAACGGGATCCAGTTCGAGCTCATGAAGCTGTTCGCCCAGGCACGCAACCGCATCACCGTCGTGGGCGACCCC
GACCAGAGCATCTACGGTTGGCGGTCGGCCGAGATCAAGAACCTCTTCCGCTTTCTCCAGGACTACCCGGGCACCGACGA
GATCTCGCTCGAGGAGAACTACCGCTCGTCGCGCTCCATCCTGGACACGTCCCTGCAGGTCATCCAGCAAGACCAGAAAC
GCTACCAGAAAAGCCTGCTGCCGGTCCATAAGAAGGGCACCCGGCCGGTACTCCGGAGGCTCGAAGACGCCCACAAAGAG
GCCAACTGGATCGTGTCGGAGATCCGCAGGGCCATGCTGATGTGCGGCAAGCTGCTCGACCACAGCGATGTGGCCGTTCT
AGTCCGCTCGGCAGCCCTCTCGCGGCCGATCGAAGCGGCCCTGAACAAAGAGGGCGTTCCGTACCGCATGATAGGTTAGC
CATCCCTCGCTCACCTCTGGCGTGAAGCATACTGACACGAGCGCTGGATCGCAGGAGGGAGGAAATTCTTTGACCGAGCA
GAAATCAAGCTCCTTCTCGACTACCTACGCGTCATCTACCAACCCGACAACAACGAGGCCCTCTCACGAGTCATCAACGT
ACCGAGACGCGGTGTTGGCGTCAACTCTCTAAAGTCCATGCTCGAGCAGGCCGAGTGCGAGAAGATCAGCCTCTGGACGC
TGGTGACTGGGTATCTCCGAGGGGACCGCCAAGTCCAGGTGAACCTGAAGAATGCGGAGAAGAGGCTCAACGAGGGCCTA
TTAGGCCTCGTGAACGGCATTCGAGCCAACACCGATACGGGAGAGGAGACTCGAGACGATCAGCCCCGCAAGAAGACGTT
TACGCTCATCCAAATCATCGAGTCTATTCTCGTCAGGCTGAACTTTAGGGACTACATCGAAAAGACATATGCGCCAGAAG
ACGAGGCACGATGGGCGAACGTGGACGAGTTCAAGAACCTTGCGCGCGAGTTCATGGCCAAGGTCGGGGAGCTGGAGGAG
GAGGACCAGCTGCCCGAGGTCGAGGGCGAAGAGCAGGAGAAGGAGACGAGCGTGCTGGGCAAGTTCTTGGCTACCGTCAG
TCTCGTGTCGGACGCCGACAAGGCGTCTGAGGATGACAAGAAGCCAATGGTGACGATATCCACGATCCACGCGGCAAAAG
GTCTGGAATGGCCTGTAGTGTTCATTCCGGCTGCATACGACGGCTCGCTGCCCCATAGCCGATCGGAAGACACGGACGAG
GAGCGCCGTCTGCTGTTCGTGGCCATGACTCGAGCCAAGTGCCTGCTGAACATCAGCTATTCCGTTCGCAGCATTCACTG
GCGCGAGAACGACGACCAGGGTCGCGATAACTACGAGCAAGACCTGTCGATGTTTCTCTGCCCTGTTCCGTCGGCCTGCT
TCGCGGAAAAGGGGCCGTCGTATGACAGAGGCCTCCTGGAGGAAATCGGTGAGATTCTCGGCCGTAAGGTACCCTCAGAC
AGTGACATCTACAAGACACTGCCAATAGGATCGCGGCTGGAGGACGACCAGTATCCCATCGACCTCGATGCCGCGGTCCG
GTATCGCGACGAAGACGAGTATGGCGGCCGTTCTGGTGGTGGTCCACGAACGAAGCGACGGAAGACGTTCGAAGCAACGG
GCGGCATATACGCCGGATCCGGTGCTGGGGCTGTGTCCTGGCAACGGGGCTACTCGACCACGATGGAGTCCATGCCTGGA
TTTACGACGGCCAGCGCCCATCAGACAGCACTCTTGGCTGCCGAGGCTGCTGCTGCTGCTGCTGATGGCGCTCAAGCAAA
GGCCAGTGCGAGAGAAAGGCGTGCAGCAGTGCCTGCTAGCCAGCAGACGATCACCATGAGTTTTGGTCTCACCAGTGCAG
CAGCATCGGACTGCACCCAGATGCCCCCGAAGCCATCTGGGTTTCTGGCCGCCCACCAGCCAAGGGCAGTGGTTGTGCCG
GCAGGCATTCCTCCAGAGCTGACCAACCGCAGGCTCGGAGGGATCATGCCGAAGATCAAGGCCGGCCACCCGTCAGTGAC
CAAGACCGGCTCGGCCAGCAACTTCTCCGACCAGAGCCGACCAGACAAGCGCTACGCACACTTCTCCAGCTCGCCGACAC
GGCCTGACAGCACGGTTTTCCTGCACGAACCACAAGCACCGCCGCCACCACAGCCGCGGTTTGTGCCGCAGACAACGCGA
TTTCATAATCACTACGTCCGACCTGAGCCGAAAGACAGTGGCTACGGTTATGCTGGGCGCGGAAAGGAAAACCACAACAT
AACCAACGAACACGCCGGTGTCGGCACGGCTGCCCCGGCGACAGCCACGAGGCCAGCAGCAAGCCTGCACAACACCAGCT
TTGCACAGGCAAATGCCGGCGTCGCGCCCTTGGACAAGCTGCGACAGCCGTTCAAACCACCGAGTGTCAGGCGGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62