GenePrediction:GLEAN_8166 Details

Name: GLEAN_8166
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:611529..609029 (- strand)
Length: 2501
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:611529..610807 (- strand)
Length: 723
Type: CDS
Source: GLEAN
Position: GCSC_113:610732..610403 (- strand)
Length: 330
Type: CDS
Source: GLEAN
Position: GCSC_113:610344..610198 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_113:610147..609029 (- strand)
Length: 1119
>GLEAN_8166 class=GenePrediction position=GCSC_113:611529..609029 (- strand)
ATGTCGGGCCCGCAATACGCCTACGCCATGATGCACCTGGCAGGTGGCAGGGATGCGGGCAAGCAAAGAAGACACCAGGC
GCCCAACCCGCGAAGAGCCGCGTTCACGGCCCTTGCAGCTGCGGCGTTATTTGCGCTGGTCTTCTTTTCAGTGTGCAAAC
TTGGCAAGCCGGCCTCGTCTGCCAGCTCTCCGAGAGGGGCTTCGTCTGCTGCCGATTTGCCGCTGTCGTCGTCCCCCTTC
TCAGACGCCAATCTCGGACCACCTCTGCTGTCACGGTCTGTTCCGGCTGGCGACAAGTATCTGATCGGCGTTGGCAAGGC
CGACATCACCGGCCCGGTGGTCGAGGTGAATCTGGGAGGCTATGCCAGCCTGTCACAGATCGGCTCCGGCCTTCGGCAGC
GGGTCTACGCGCGCGCATTTATCGTTGGTGACGTCTCCACCCCGTCCGACCGCATCGTCTATCTGGTCATCGATACCCAG
TCGGGCGACACTGCCGTCCGCTTGGGCATCTTGGAGGGACTGGCTGCCCTGGGCACAGACTATTCCATGTACGGGGCTTC
CAACGTGGCCGTGACGGGCACTCACCAGCACAGCGGGCCGGGAGCCTGGTTCAATTACCTGCTCCCGCAAATCACCAGCC
TCGGCTTCAGCAAGCAGAGCTACCAAGCCATTGTTGATGGCAGTGTGTTGGCGATCCAGCGAGCACACGAGTCGCTGACG
ACGGTATTTCATTCCTGCCTTAAGTGAAGGGGGATGAGCCAAAGAAAAGCTGAAGCTGACCAGTGCACCAATGCCAGGGC
TATCTCGATGTGGGCAAAACCAACATCACGGACGGCAACCTTTCGCGCAGTCTCTACTCATACATGGCCAACCCGGCTGC
AGAGCGGGCAAAGTACAGCACTACCACCGACACGGAGATGACGCTGCTGCGCTTTCAGCGAGCATCTGACCTGAAAAACA
TCGGCGTGCTGTCGTGGTATCCGGTACACGGCACTTCGATGCTAGAGAACAACACCCACGTGACGGGCGACAACAAGGGT
GTAGCGTCGTACCTCTTTGAGAAGGCCATGCTGGACGATGCAGACGCAGCCGAAGGCTTTTGTTGCCCGGCTTTCTCGCA
AGCCAACGTACGGCGACACGACGCCAAACACGCTGGGCGCCTGGTGCGACGATGGCTCTGGCCAGATGTGCAGCTATAAA
AACAGCACGTGTGCCGACGGCAAGTCGGAGTCGTGCCACGGCCGCGGCCCTGAGTTTCAGAAGCTCGATCTCGGCGTCTC
CAGCTGCTACGTGATCGGCAAGAAGCAGTCTGACGGTGCCAAGACTATATATGTAGGCAAAACTCGAGCTCTCATGTTGT
GGCCTTTCGCTAATATCAGCAGGACTCTCTGGCTACGTCGTCTACTCCGATTGTGGGAACGACGGTGAAGTCCTTCCACT
TCTACCAGAACATGAGCTATTTCCAGTTCGAGCTGCCTAACGGTACGGAAGTGCAGACATGTCCTGCTAGCCTGGGGTAC
TCGTTTGCCGCCGGGACGACAGACGGCCCTGGAGCGTTTGACTTTACGCAGGCCGATTCGGGAAGCTCGACTGCCAATCC
GCTGTGGTCTGTGGTTTCGGGTGCTCTTCGCACGCCCACGGCTGCGCAGAAGGCATGCCAGTACCCAAAGCCGATCTTGC
TGGACGTTGGCGAGATGGACGAGCCGTATGCATGGACGCCCAACATTGTGGACATGCAGTCGATGCGCATCGGCCAGCTG
ATTATCATCGTGTCGGCGTCCGAGGCCACGACAATGTCGGGCCGGCGGTGGCGGGAAGCCGTGCACAAGCAGGCAGCCAG
CACGATCCTCAAGGACGGAGCCGATCCGGTGGTCGTTCTGGGGGCACCGGCCAACGTGTATGCGCACTACTGCGCGACAC
CGGAAGAGTACAGCATCCAGCGGTACGAGGGCGCCAGCACGCTGTACGGGCAGTGGGAGCTGCCGGCATACATCAACCTG
ACGCTGCGCAACCTTCACTACCTCGCGGCCGACGCGACGGGGTCACCGGACGCCGGTCCATCGCCGCCCGACAATCGTGA
GACCTCGCTGAGCTTCATCACATCGGTCGTCTTCGATGCGGCGCCCAGCGGCAAGTCATTTGGCGAGTGCATCGACCAGC
CCAAGTCGAGCTACGCCAAGGGTGACGTGATCAACGCCACGTTTGTGGGGGCCAACCCGCGCAACAATCTGCGGCTGGAG
GACACGTTTGCGGCGGTGGAGAAGCACGACAGCAGCAGCGGAAACTGGACGCAGGTGCGCAGCGACGAGGATTGGTCTCT
GGTCTACACATGGGAGCGGACCAGCACGGTGCTGGGCTACAGCCAGGTGGTGCTGAGCTGGGAGTCGGAGGCCACGGCAG
CTTCAGGCACATACCGACTGAAGTACTATGGCGACTCGAAGCCGCTGGTCGGGTCGATCTCTGCTTTTACTGGCATTAGC
AACTCGTTCACGCTGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62