GenePrediction:GLEAN_8167 Details

Name: GLEAN_8167
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:607538..606364 (- strand)
Length: 1175
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:607538..607502 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_113:607439..606364 (- strand)
Length: 1076
>GLEAN_8167 class=GenePrediction position=GCSC_113:607538..606364 (- strand)
ATGTCGTCCTCAAGCCGTGTTTTCATTGCCATTATTGGTAAGGAACCGTCTGTCTGTCTAGAGTCTAGTCGAGCATATGG
CATCTGACAATCGGTCTAGGCGCTGGTGGCGTGGGTAAATGCTTCCTGTCACAGCTTGCCGACCTCGCGGCACGGCGACC
GTCGCCACGCCTCAGCCTGGTGTACATCACGACGACCAAGAAGGCTGTTTACCACAAGGACTACTCCGAGGTCGGCATGA
CGGACGCACTGGACAGCCTGGCCGCATCGACCCAGACGCCGCTGTCGATTGCGGAGACGATTGAATTTCTGGCAGCAGCA
CCGGCCAAGGTGGTGCTGGTGGACAACACGAGCTCGCAGGCGGTGGCAGATGCGTACCCGGCGATCCTGGGCCGTGGCAT
CAGCATCGTGACGCCCAACAAGAAGGCCTTTGCCGGCTCCTTCCAGGCGTGGCAGGACATCTTTGGGGCGGCTGCGAAGT
CGGGTGCCAAGGTGTACCATGAGGCGTCGTGTGGCGCCGGGCTGCCGCTGATCTCGACGGTCAAGGATCTGGTCGAAACC
GGCGACCAGATCACGCGTATCGAGGGCATCTTCAGCGGCACGCTGTCGTTCCTGTTCAACTCGTTTGCGCCGGCCACGCC
GGCCACAACGACCGGTCCGTCGCCTTCCTGGTCGGCCGAGGTGGCCAAGGCCAAGGAACTCGGCTACACCGAGCCGGACC
CGCGCGACGACCTCAACGGCATGGACGTGGCGCGCAAGCTGACGATCCTGGCGCGGCTGGCCGGCCTGTCGGTGGCTTCG
CCGACAGCGTTCCCGGTTGAGAGCCTGATCCCGGCCGAGCTGGCGTCGGCGGCCAATGGTGACGAGTTTCTCGCCCGGCT
GCCCGAGTTCGACGCGCAGATGGAGGCTGTCAAGGCAGCCGCCGAGAAGGAGGGCAAGGTGGTGCGCTATGTCGGCAGCG
CCGACGTGGCGACCGGCCAGCTCAAGGTCGGGCTCCAGTCCTTTGACCGCGCCCACCCCTTTGCCGCGCTCAAGGGCAGC
GACAACATCTTCAGCTTCCACACGAAGCGGTACGGCAGCAACCCGCTCATCATCCAAGGTGCCGGTGCCGGTGGCGACGT
CACTGCCATGGGCGTCACGGCCGACCTCATCAAAGTGCTGTCTCAGATTGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62