GenePrediction:GLEAN_8169 Details

Name: GLEAN_8169
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:597832..596257 (- strand)
Length: 1576
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:597832..597490 (- strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_113:597419..596257 (- strand)
Length: 1163
>GLEAN_8169 class=GenePrediction position=GCSC_113:597832..596257 (- strand)
ATGAAGATGCAGGGCAGCCTTCTGGCGGCAGCATCGGTGCTGGTGCCGCTCGCCAGCGCGGTGACCTATGTGACGGTCGA
CGGCGGCGAGTTCGTCAACAACGCCACGGGCAACCGGATGGACATCATCGGGGTGACGTATCAGCCGGGCGGCTCGTCCG
GGTTTGACGGCACGGCCGACCCACTCAGCGATGCGGACGCCTGTCTGCGCGATGCCATTCTGATGCAGCAACTGGGCGTG
AACACGTTGCGGGTGTACAATGTGGCGCCGGATCTGAACCACGACGAATGCGTGTCGATCTTCAATGCGGCCGGCATCTA
CATGCTGATTGACGTGAACAGCGGTAAGTTTTTTTTTTTTTTTTTTTTTTTCGTTCGTTTCATCCTCCTCCTCCACCCTT
TCTAACCGCCCAGGCCTCTCTGGCCAGTACATTGACCGGTCCGACCCCTCGACCACATACACGCTCGCCTACCTCAAGCA
CATCTTTGCCGTCGTCGAGGCCTTCTGGGGCTACCCCAACCTGCTCGGCTTCTTTGCCGGCAACGAGGTGCTCAACGAGG
ACAGCTCGGACGATGCGGCCATCTACATCCGGGCGATCGTGCGCGACCTCAAGGAGTACATTGCCCTGCACAGTCCGCGG
GCCATCGGAGTGGGCTACTCGGCCGCCGACGTGGACACAATGCTGAGCGACACGTGGAACTACCTCGGCTGCACGCTGGC
CAACTCGACGTACTCGCGCATCGACTTCTTCGGCCTCAACGACTACGAGTGGTGCGGCGACAGCAGCTATACCGAGTCGG
GCTACAACAAGCTCGTCGCCGAGTTTGCCGACACCGACATTCCCGTCTTCTTCAGCGAGTACGGCTGCAACCTGGTGACG
CCGCGCACCTTTACCAACGTGCCCGTGCTGTACGGCAGCGAGATGACCGGACTCTCGGGCGGCCTCGTGTACGAGTACTC
GCAGGAGACGGACAACTACGGCCTCGTGGCCATCAACAGCTCGACCGAGGTCACGCTGCTGAGCGACTTTGTCTCTCTCA
AGGCCCAGTACCTCTCGCTCGACCAGTCCCTGCTGATGACCGCCAACAAGTCGCTCGCCTCGGCCTCCACCTCTACCTGT
GGCGCCTCCCTGATCACCGAGTCGGCCGTGCCGACGAGCTGGGACCTGCCCGACCGTCCGTCTGGCGGCAACGCTCTGGT
GACGTCCGGTCTCACCAGCGCCAGCACCGGTGCCCTCACCAGCGTAACTGCCACCACTATGCCTGCCACTGTCTACGACA
CTGCCGGCTCCACCGTGACTGGTTACAGCCTCGTCTCGTTCGGCTGCTCCGATGTCAACTATCCCGGCCTGGCCAAGACC
TACAGTGCCTCCGCCCAGACTTGCGTCTATGCCTCGTCCACCGCCAAGTCCGACGGGTCCACCGCCGGCAGCGGATCCAG
CACCAGCACCAGCACCAGCACCGGCAAGAAGAGCGGTACCAGCCGCACTGCCGTCGGTCCCTTTGCCGACAAGTTCGGCC
TCGCCATCACGGCCGGCCTTGTCATTCTCTCTCTGGGCGGTGCCCTGGCTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62