GenePrediction:GLEAN_816 Details

Name: GLEAN_816
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:216480..217499 (+ strand)
Length: 1020
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:216480..216754 (+ strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_132:216827..217499 (+ strand)
Length: 673
>GLEAN_816 class=GenePrediction position=GCSC_132:216480..217499 (+ strand)
ATGGCCACAAACGGAACCAACGGCACCACTGGTGCAAGCAAGTTTGACCCCAACTTTACGGACCATGTGATTGGTCTGAT
GAGCCCCGAAACGACGCCGAGAAACCGACAGATCCTCACGTCTCTGATCCGGCATATGCACGACTTCTGCCGGGAGGTCG
AGCTTACGCAGGAAGAATGGGTCATTGGGGTCAATTACGTCAACTCCATTGGCCAGGCGTACGAGAAGAACCGGAACGAG
GCCTGGAGAGTGTGTGATATCCTGGGCATCGAATCGTGAGTTTGGGTCGTCCTCTGGAAGTCTGCTTGGGCTTCGTTCGT
TGCTGACATGGTTTCTCCCGCGTCTAGTCTTGTGGACGAGATCAACCACAAGATCGTCACGCCCGAAGGCGTTGTTCCCA
CGTCGTCCGCCATCCTGGGCCCCTTCTGGTCTCCCACCACGCCCTTCCGCGAGCTCGGCGCCAGCGTGATCCAGAACATG
CCCAAGGACGGCCAGCTCACCTTCTTCCACGGCCAGATCAAGGATGCGGAGACCGGAAAGGGCGTTCCGGGAGCGGTGTT
CGACATGTGGCAGGCTAGCACCAACGGCAAGTACGACGTGTTTGACCCGGAGAACCAGACGCCGCACAACCTGCGGGGCA
AGTTCCGCGCCAACGAGGAGGGCAAGTTCTGGTTCTACTGCCTGAAGCCGACCGAGTACGCCATCAACACGACCGGGCCG
TCGGCAGAGCTGCTTCGCATGACTGGCCGCCACCCATACCGGCCTGCACACATTCACATGATGATCACGCACGATGACTA
CATTGGCGTGACGGCACAGCTCTACCCGAACGATGACCCGTACCTGGAGACGGACACGGTCTCGGCCGTCAAGGACGACC
TTCTGCTAGACTTTAAGCCGGCGGTTAACGACCCCAAGGGAGCCGTTCTCGACGTGGAGTACAACGTCCGTCTGCTGTCG
AAAAAGTACAAGCCAGACAGCACGATGTTGATGAGCAACGCAAACCAGGACAAATTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62