GenePrediction:GLEAN_8172 Details

Name: GLEAN_8172
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:582428..581362 (- strand)
Length: 1067
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:582428..582250 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_113:582130..581528 (- strand)
Length: 603
Type: CDS
Source: GLEAN
Position: GCSC_113:581467..581362 (- strand)
Length: 106
>GLEAN_8172 class=GenePrediction position=GCSC_113:582428..581362 (- strand)
ATGTCCGGCTCCACTCAGATTCCGGCAGCTGCCGTTTCGGACAACGTCAGCAACAATGAACACCTCGTCGTTTCAGATGA
CCCAGAGCACCCAGCCAACCTGATCCCCAAGCTGTGTGCCAAGTTCTGGACGCTGGGCTGGGTGACGGGCACAGGTGGCG
GAGCGTCAATTCGCAATGGGTAAGTAAGAGAGAGAGCAGAGGGACGATGTTCACGGCCAAGAGATCTCGAGAGTTGGATT
ATGTGCTAAGCAAGCGCCCTCTTCTTCTCTTCCTGCCCGGTTTCGTGCTCATGTGCAGTGATCTTGTCTATCTGGCGCCA
TCAGGCGTGCAAAAGGAGCTCATGAAGAGCCAGGACATCTACGTCCTGTCGCTCGAGGCACAGGCGCGCTACTATGCGGA
GCAGAAGGCCGAGAACGACGCCAAGGTGGCAGCAGCACGGGCAGCCAACAGACAATTAACCGGACCATGGCGACCGCTTC
GCACGTACCTGCGCAGCCCGCGCGGACTGAAACCGTCGCAGTGCACGCCGCTGTTCCTGTCGGCGTTCACGCGGCGCAAC
GCCGGCTGCTGCATTCACACACACAGCCACTGGGCCGTGCTGGTGACGCTGATCCTAGAGCAGGAGGCCGAGTCGTTTCC
CGGCTCGCGACGTGAGTTCCGCATCAACAACATCGAGCAGATCAAGGGCTTCAAGCGCGGCTACGACAAGACCGGCAACC
TGGGTTACCACGACACGCTGTGCATCCCCGTGATCGAGAACACGGCGCACGAGGAGGACCTGACCGAGTTCCTCGAGGCG
GCCATCGAGAAGTACCCCGACACGTATGCGGTGTTGGTGCGGCGCCACGGCGTCTACGTATGGGGAGACTCGGTGCACGC
GGCCAAGACGCAGTGCGAGAGGTACTGCCCCTCGTCCGCCATTGTCCCTCCTCTTTCTGGCTCAAGCACTGACACCTCCA
GCCTTGACTACCTCTTCCAGCTAGCTGTCGAGATGAAGCAGCTCCACATTCCCTGGATTAGCAACGTTGAGGAAGTGCTG
CCTTCGGAGCAGCGAAGTACGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62