GenePrediction:GLEAN_8175 Details

Name: GLEAN_8175
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:575795..573610 (- strand)
Length: 2186
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:575795..575374 (- strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_113:575318..575171 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_113:575111..574991 (- strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_113:574929..574698 (- strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_113:574642..573610 (- strand)
Length: 1033
>GLEAN_8175 class=GenePrediction position=GCSC_113:575795..573610 (- strand)
ATGGCTATCAGCCAGTTGGTGGTGCTTTTCCTGTTAGGCTGCATCGCACCGACGAGCTTTTGTATAGCGGACGTTTCGGA
GTCCCAAAAGCCTGGCGGTAGCGAGCAGCCCGATAGATCAACCACGGCAGACCCGATCGAGAGTCTCTCCAACGACTTCG
GCCTCGGGTGGCAACCCTTTGTCGAGGCCCGACCTGCTCTCACTGGCCACCACAAGGCACTACCGGAGCTCGCCAAGCGA
GAGTGCCTGGCCAACGGCACCAATTTCTGCTTCGGCAACGACATCAACTACTGCTCTTCTTGTGGCACATGCTGCTCGGG
GTCGAGCAACAAATGGTGTTGTTCATCCGACAGCATCTGCTGTGGCGATGCCTGCTGTGGGAGCGGGCAGACGTGCAGCA
AGGGAAAATGCTACCTGCCGGTGTAAGTATGGAGAGAGAGTCGGCCATGTAAGGGTACACACAGCTGATGTCTTCAGGGT
TACGGTGACGACGCAAAGCACGCACACGACCACAGCAACATTGACGGCGACAGCGTTGACCACTGTTCTGAAGGTTGTGG
TCGTGCAGGCCCTCACCTTTTCCATCACCGAGTCGACAGTAACGGACAGTTCAGGCACGCAGACGGTAAGACAACCGATG
TACCTGCCGACGAGCTGCTCATCACGGCTGCTGACTTTCATTAGGACTGGTCCGTCGTGACAGTGACGTCTGCGGTCAAC
AAGAGGGCCGTACAGACCGTTCACAAAGAGATGGGCAGCAATGACGGCTGTAGTGCGGATGATGGGCTGGAGCCCGGTCT
TCCAGGTAGGTTCACGGATCGTTTCTGTGAGGCTGCCGTTTCTGTGTTGGATGACTAAGACCACAGGCCTTCCGACGACA
CTCACACTGGCCCCAGCTGCCTTTCGTCGCCGGCACTTCAACCATCGTCGTCGAGACGCCACGGCCACTACGGCCAGCAA
TCTTGTTTCGACGGCTGCCACGTCGACAGTCACCGACGCCGTCACGGTGACCTCTGTTGTGACGCACAACGTCGCCACCA
CTACAACCGTGATGACGACCTCGACTCAACTTACCATTGTCTACCAGACAAACACAAAGTTCGTCCTCCTCCACCCTTTC
CGTCATCTGATGTGCCTCTCTGACTAGAGCCAGGGTTATCAACGCCATGGCGACCGTTTCCTCGACGAGCACATACATTT
TCGCGTCGCAGAATCCCGTCACCAGCACCAGCATCGTGGTGGCAACTATGATCGAGTCGTCCACACCCGCAACATCGCAG
CCAAAATCTACTGCGGCGTCGCCGTCTCTCGTCACCGAGCACTCGAGCACTCGCTCGTCCCATTCGGGACTCTCCTCCTC
TGCCATCGCCGGCATCTCCGTGGGGTCTGCTGCTGGTGCTATTCTTCTGGTGCTGCTTGCCTTTTGTGCCGTACGACGTC
GCCGGCGTAAGAAGCGTCGGGCTATCGAGACGGGCGATCCCTATCTGGGCGGCGGTGTCGTGCAGCACAACTACACCGGT
CCCCCCCCACCGGCTGCTGCTGGATACGGCCGCGGCCTCCCCTCTATGCAGCAGCAGGCCGGCCTGGGACTGCCGCCCGT
CCCGTACTTTTCCAATGTGGACGACTCGCCGGCACTGTCGCCCGCCACAGATACCACAAATACCACCGCTGTGAACTCGC
CAGTTCGAGAACACCACAGCAGCATGTCGAGCACGTCCTCGGCAGGACTGCGACCTGCCGGGTCCTTGGCCTGGAAGCTT
TCCGATCCTGCAGCTGTTGCGGCTGTTGCGGCTTCTGCAGCCGCCGTAACCGCATCGGCTGGTGGAAGAAACAACCTGCA
CTTACGGTCCGGCAGTGGTGCCACAACGGGAACAGTCACCAGCTCAACTGCCGTAGGAACCAGTGGCCGGAACAGTCTGA
GCAGCGCCTGGCAACTCGGTAATGCCCAGCACCAGCGGGATTCGTCCATGGGCAGTGGGATGACAGCACAGATGCCCTCA
CATCTGGGCGAGGACATCGGCGGCCGTGTTGGTCCGTCTACAGAGCTGCCGAGACATTCGCTGCATCAGAGTACCCCAGA
CGCCGCCAGTAACGACCGCGAGACGACCGGCTGGCGCACTGGCTTCCGAAGAAGTCGCACCAACACGGTGACGCAGGGCG
GCGGCTTCTTCTATCGAGACTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62