GenePrediction:GLEAN_8177 Details

Name: GLEAN_8177
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:557029..554866 (- strand)
Length: 2164
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:557029..556735 (- strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_113:556097..554866 (- strand)
Length: 1232
>GLEAN_8177 class=GenePrediction position=GCSC_113:557029..554866 (- strand)
ATGCTCGTCCTGCTTTCGATCATCCTTATTCGCTTGGCCACACCGGTCGCGAGTCAGATGTACGACTACGGCTTCGAAGT
CGATCATCACCTGTTCCAGAGCCACATACAGCTACGGGATACTGCCACTCCCTATGTTGTAGGCAATATCCTTCATGCCA
CTAACACTACTGCAGTGAGGCAGGAGATCCGAAAGCTGGAGCAGGACCCGGATTTGTGGACATTGTATATGTTGGGACTT
AACATGATGCAGTACGTGGACCAGAATCAGCTGCTCTCGTACTACCAAGTCGCAGGTATGTCTATCTCCTCGCTAGAGCT
CGGACGGTCTTGTCCTGTACGAGCGAGAAGAGTCTGACTTGGCAAATAGGCATCCACGGGGTACCATGGATCGAATGGAA
TGGTGTCCCGGCCACGGCAGGAAACGAAAACACCGGCTACTGCACACATGCATCCATACTCTTCTTGACATGGCACCGTC
CTTATCTTGCTCTGTATGAGGTAAGGGTCTTCTTCGACCTCTTCAAGATACAGACCATTCTTACAAGATACAGCAAGTTC
TATACACTCTAGTACAGTACATTGCTTCCTTATACTCGGAAGACACCACAAGGTCGAAATACGAAAGGGCTGCTGTCAAC
TTCCGAATACCATACATGGACTGGGCGGCCCAGCCACCATCTGGAGAGGGTGTTCTTCCAGATTGCGTGGGAGCGAGCCC
CTACATCAACGTGACCGGCCCCAACGGGTTGCAGGAGATTACAAATCCTCTGTATACATATTTGTTTAAGCCCCTGAACG
CTACCATATTCATTGAAGATCCGGTTCGTGACAGTCTTCCACTGCTCCTGCGAATTCTTCGGCTGATAGATTGTTAGTAT
GATCTGTGGCTCACTACCGTCCGAGCACCGACCACCAGCAATTCCTCAGCAGGCTCCAATGATACATTGGTTGCTCTGGC
CCTGAACAGAAACTTCGAGTCCATCCAGCAGAGGCTCTATAACCTATTTTCAAATTACGATTCCTATGGTAACTTTAGTA
ACAAAGCGTGGATTCCGCCATCTGATAGCGGGAAATACGACTCTCTGGAATCTTTGCACGACACCATACACAGCCTCGCC
GGTCTTCAGGGGCACATGTCCTGGATTCCGTTCTCATCTTTTGACCCTATCTTTTTCCTGCATCACTCCATGGTCGATCG
AGCTTTCGCTCTGTGGCAGATACTGTACCCGGACTCATGGATCAAGCCCACAGCCGCAACCTCCAATAGCTTCACGACAT
CCACAGGACAGATCCAAGACTCGAAGACGGCGCTAACGCCTTTTTACTCCAGTACAAACGGCACGTTTTGGACTTCAGAT
ACCGTCAGAGACTTTGGCGTATTCGGATATACATACGACGACATGGTGGATTTTCCCAGGTCGAGCCTGACGGTGGCTAA
TGCCACGACTCAATCACAGGTGAAGGCACTCATCAACCAGCTGTACGGAAAATCCAGCCCGGCAATGCTTGGAGTAGTCG
GAGAGGAGGATGAGGGGGTGACAGAAAGAACGATGGCGCAGACGACGAGACGGTGGACAGGCCCAAGGCAAAAAGAACGG
ATGGAACATGAGGTGAAAAACTGCACTAACGTACAGACAAAGCCAATATTGCCGCACAGTTATGATTCGCCACAGTCGAT
GCCCCAGTCACTTATCGCAGATGGCCATTACCGGGAATGGCTGGTCAACATTCGTACGAGGAAGGAAGCCACTGGAGGAG
CATTTCTTGTGCACATATTTCTGGGCAACGTATCAACGGATACGAGATCGTGGGCGTATGCCCCCAACCTTGTGGGGACA
ATGGGCGTGTTTGCGTCTCCTGCAAGTGCTATGACGGGCATGGACATGAAAGACAGCCACGCTTTTGGAACGGTGCCGTT
GACCTTGCCCTTGGCACAGCGGGTTGGGAGTGGAGAATTGGCAAGCTTGGAGCCGGAAGTGGTACAGCCATACCTTGGAC
GCAACTTGAAGTATGCTGTTGCAACTACAGGTGGTGAAGCCGTTGTGCCCAAAGATGCAAGTGAACTCAGCATCACGGTG
GTGAGCTCTGTGGTACAAGTCCCGTCAAAGGCCAACGAGCTACCTCGATGGGGTGATATTGCGGTCCATTTTACATTGAG
TTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62