GenePrediction:GLEAN_8179 Details

Name: GLEAN_8179
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:538558..537312 (- strand)
Length: 1247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:538558..538439 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_113:538391..538343 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_113:538270..537430 (- strand)
Length: 841
Type: CDS
Source: GLEAN
Position: GCSC_113:537369..537312 (- strand)
Length: 58
>GLEAN_8179 class=GenePrediction position=GCSC_113:538558..537312 (- strand)
ATGCAGTTGCCCGTGAGGCGGCTGGCCCTGCTGGCCATTGTGCTGGCGATGCTGGCGAGCGTGCCGGGCGCGACGGCGTC
GGTGGGCGACCGGCTGCCCGAGTTTCGCGAATGCGTCGAGGTGAGCAGTCTGGGAGTCGTGTCTGCGGGCTTGTCTGACG
ATTCCAGGTGTGCAGAAAGGAAAACTGCGGTTCCGGCAAGGCGGCGACGCCGATTCGTGAGTCTTGTGGTGTCGGCTCCT
TCTGCTCGTTCGTTCCCTCGCTCGACCAATCTGACCTCTGACCCTCAGCCCTCCATCTCCGTCTCCTCCTCTGGGACTGT
GCGGCCGAGTGTGATCAGACCTGCCAGCGCATCGTCACGGCGCATCGTCTGGCTGCCGGCCAGTCCGTCGAGCAGTTCCA
CGGCAAGTGGCCCTTCCGGCGGCTGTTCGGCGTCCAGGAACCGGCTTCGGTGGCCTTCTCGCTCGGCAACCTTTGGGCGC
ACGTGACCGGAGTCCGCCGGCTGCGCCAGACGCTTCCGGCCAGCTACCCGCTGCTGCCTTTTTACCTCGGCTTCGGACTT
GTCGGCTCGGTCTCGTGGGTCTTTAGCAGCCTCTTCCACACCCGCGACTTCGTCCTGACCGAACGGCTCGACTACTTTGC
TGCTGGCGCCTCCGTCATGTACGGGCTCTACTACACGCCCGTCCGGCTTTTCCGCCTCGACCGCTTCGATCGCCTCGACG
GCATCGGCAGCTCAGCCAGCAGCCCCAACACTAGCCGTCGCGATCTCTCTCGTCGTCATAATCGACCGCCTGCTCCTTGT
CCCCTCGTCCTCCTCGTCTGGACCGCCCTCTGTGTCGCCCTCTACGTCGCTCATGTCGCCTATCTCACCCTCGTCCGCTG
GGACTATGGCTACAACATGGCCGCCAACGTTGCCTGCGGCATTGTCCAGAATGCTCTCTGGTCCTGGCATTCGTGGCGAC
AGTGGCGTCTCACTCGTCGCTTCTGGACCGTTTGGCCCGGTCTCGCTGTCGCCTGGCTCACCCTCGCCATGAGTCTTGAG
CTGTTTGACTTTCCGCCCGCCTTTGGCATCTTCGATGCCCACTCGCTCTGGCATCTCGGCACCATCGGTCCCACTGTCAT
CTGGTATAAGTAAGTCATCTGCTCGTTCTTCTGTCCTTCTCTCCGTCTTCTCTTCCCTGACTCCCCCAGCTTCCTCGCCA
AAGACGCCCTCGACGACCTTTCCGGCAAGGAGAAGGCCGAAGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62