GenePrediction:GLEAN_817 Details

Name: GLEAN_817
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:218356..219602 (+ strand)
Length: 1247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:218356..218519 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_132:218578..218747 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_132:218814..219058 (+ strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_132:219122..219264 (+ strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_132:219323..219602 (+ strand)
Length: 280
>GLEAN_817 class=GenePrediction position=GCSC_132:218356..219602 (+ strand)
ATGCATATTTTCACAGCGTCACTCCTGGCCATGCTGGCTTCCGTCGCGGTGGCAGTGCCAACCCGAACTCTTCAAGGCGA
TTCTGCCGTGCACCGTCGGACGGTTCAGAAGAGAGCTTCCATCACGGATGCCTGTGATATTGGCTACGCCACCGAGAATG
GCGGGTATGTGTGCAAGCGTGCGCCCGGTGAGATCCATGGCTGACTGTGCATCTAATGACAGGACGACTGGCGGCTCAGG
CGGCACGACCACGACGGTGTCGACGCTGGCCCAGCTGACGGCGGCGGCCTCGTCGAAAGACTCAATGGTGATCGTCGTGA
GCGGTGCGATTACCGGGGCAGACAAGGTGAGGGTGGCGTCGAACAAGACGATCATCGGCGCATCTGGCAGCTGTACGTTT
TTCCACAGACAATTCCAAAGATTTGAAGGAACATGACTAAGACAGACTTCCTATGCAGCCATGACAGGAGTCGGCCTCTT
CATCAGTAAGGCGTCCAACGTGATCGTGCGCAACATGAAGATCAGCAAGGTTCTGGCCGCGAACGGCGACGCGATCGGGA
TCCAGGCGTCGAACAACGTCTGGGTGGACCACTGCGACGTCTCCAGCGACCGGGACCACGACAAAGACTTCTACGATGGG
CTCATGGACGTGACCCATGCCAGCGACTACATCACGATCTCCAACACACACCTGCACGATCACGTAAGCAAGAAATGTGG
AGAACACCGAACGAGGCAATGGCTGACAAAGACGCACAACAAACAGTTCAAGGCCTCTCTTGTGGGCCACTCGGACAACA
ACGGGGCTCAGGACACCGGGCACCTGATCGTGACGTTTGCCAACAACTACTGGACCAACGTGAACAGCCGGGGACCATCG
GTCCGGTTTGGCACGGGGCACATCTTCAAGTAAGGCAGCTCGTGGAGAGACATGTGAGATCTCTGCTGACATCTACCTTG
TGTACAGCTCCTACTACAGCAACGTCAACGACGGCATCAACACGCGGATGGGGGCGCAGCTTCTGATAGAGTCGTCGGTG
TTTGAAAACGCGAGCAGCGAGGTGATTTACTCGGCCTACAGTCACTCGGCAGGCTTTGCTGTGGTGAAGGACGTGGACCT
GGGCGGCTCGAAGAACACGGCAGCGACGGGAACGCTGACGAGTGTGCCGTACTCGTACAAGCTTCTGGGATCAGCCAACG
TGAAGAGCTCGGTGATGGCGAACGCGGGACAGACGCTGAAGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62