GenePrediction:GLEAN_8180 Details

Name: GLEAN_8180
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:531616..530723 (- strand)
Length: 894
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:531616..531491 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_113:531430..530723 (- strand)
Length: 708
>GLEAN_8180 class=GenePrediction position=GCSC_113:531616..530723 (- strand)
ATGCCGGGCTTCGATTTCTCCAACTACAACCGGAATGCGGCGCTGCATGCCCGCGGTGTCCCGCTGCCCAAGGCAACCAG
CACCGGTACCACCATCGTTGGGTGCATCTTCGACGGAGGCGTTGTGGTAGGTCTTAACTCATGGTACGGCTTGCATGTCT
GTCCACTGATGCCAGCAACCGGCTAGATCGCCGCTGATACCCGTGCCACGTCCGGCCCCATCGTGGCCGACAAGAACTGC
GAAAAGCTTCACTACATCTCTCCTCAGATTTGGTGCGCTGGTGCTGGTACGGCTGCCGATACAGAGTTCACCACGGCCAT
CATCTCCTCCCAGCTGGAGCTGCACTCCCTGTCGACCGGTCGCAAACCCCGCGTCGTCACTTGCATGACCCTGCTCAAGC
AGCACCTGTTTCGGTATCAGGGCCACATCGGCGCATACCTGGTCGTGGCAGGCGTCGACCCCACCGGCACCCACCTCTTT
ACGGTGCACGCCCACGGCAGCACGGACAAGCTGCCATACGTGACCATGGGCTCTGGTTCCCTCGCGGCCATGTCGGTGTT
CGAGACCAAGTGGAAACCCGAGGCGTTGACCCGCGACGAGGCCGTGAAGCTGTGCAGCGAGGCCATCCAGGCAGGTATCT
TCAACGACTTAGGATCCGGTAGCAATGTGGACGTTTGCGTCATTACGAGCGAAAAGACTACGTTGATGCGGAACTACATC
AAGCCCAACGAGCGGGTGGCCAAGCTGCGCAGCTACAAGTTCCCCAAGGGTACCACCGCCGTGCTCAACGAGAAGATTGT
CATTCGCAAGGAGGACCTCGGCAACTTCATCACAGTCCACGACGTGCCGGTGGAGGAGGAAGCTGAGGCGGGGAAGATGG
AGGTCGATCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62