GenePrediction:GLEAN_8182 Details

Name: GLEAN_8182
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:503737..503412 (- strand)
Length: 326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:503737..503704 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_113:503620..503412 (- strand)
Length: 209
>GLEAN_8182 class=GenePrediction position=GCSC_113:503737..503412 (- strand)
ATGCATCCCCATCTGGACAACGTGGACAATGCGGGTATGACCAAAGCTGGCTAATGTTGGCTTCTCGTGCCTTCTGACTC
TCAATGTGTGACTGACTAGAGGCATTTGGGATTGCAGGCTGCGCAGAGGTTATGGCAGCATTCGAAGAGTGCCACGCAAA
AGGCTTCATTTGGAAATCGATGGGAATGTGCAACGGAGCCAAGACAGCACTGAACACGTGCTTGAAGGCCGAGCGAGCGA
AACGAGTAGTGGCAAATCGATCCAACGCACAAGATAAAAATGGAAAGATACGAGCACTCTGGAAAGAGATCGATGAACAG
TCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62