GenePrediction:GLEAN_8183 Details

Name: GLEAN_8183
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:500131..496479 (- strand)
Length: 3653
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:500131..497653 (- strand)
Length: 2479
Type: CDS
Source: GLEAN
Position: GCSC_113:497551..496479 (- strand)
Length: 1073
>GLEAN_8183 class=GenePrediction position=GCSC_113:500131..496479 (- strand)
ATGTCTTCTTTCTCCTTCCCTGACTTCCCTCCAGAACCGTTGGACAGCACCGACGACAACTATCAACAATCCCCCACGTC
ACTCGGTGGCGACCTCTCCTTGCCGACTGTATCATCGTCATCCATGTTGAAACCCATCGATGCAACATCGCCGTTCCTGC
ACGACATCAATACACCTGCTGAGTCAGAGCTGAGCAACTATCAGTCCAGCAGCTACAGCGAGGCTGAGAACGGCGACGAC
AGCTGGTTCAACACCGTTGACTTCAACGCCCTAGGTGGAAATACCCTTTCGCTCCCGGACTTCCACCTGTTCGACACACC
CGTGACAGCATCGGTCTCTACTCCTGAACCTTTCTTCCAGGACTCCAAGACATATCTTATAAGCCCTGACCAGACGCCGT
CGCTCAACACTTTCTCGCCCCATCACTCTGCCACGCCTGCACAGAGGGGGCTCCAAGAGAACGTCGCCTTGACTAAGACA
TTTTTAGGCGTTGGCTTGATCTCGCCCCATCAGCTTGTAAAGCAAGAGCCGGCAACCAAGCTAGCACAGTTCAACGGTTT
TGAAGTCGACATAGCCACACAACTGACACCGGACTCGGCGAGCAGCGGTGATAGTTTGGGGAACACCAGCCACGGCGGCT
TTTCGAGAGAGGAAGGGAATACATACACAGCTGTGTCCATGGCTGGCCAGAACCCGTATGTCACTGTGTCACAATGGGAC
AAAGATGATGGCGCGGGCGGAGATAACCCCAGCCTTGCGGTTGAGGCTAGCTTTGGGCCAAAGCCCAACCAGAACTCGGC
CCTTGGCACAAGCGCTGATGACAGCACTCTGCAGTGGCAATCGCCTGCCAAGCCCGCCGTGCCTCAGTCCGTGATGCGCA
ATCAGCATGGCGCATGGGAAGTTGATAGTGTCACTGGCCTTGGAGGGATTGATCCATCCAGCCGCCTCACTACTGAAACG
GCAACCAGTCTTAACGAAGATGCCGACGCCCGGAAAGTTGCGGCGCAGAACACCGTAGTTAGCCAGTGGCTGGACGCTAC
TAAATACGAAGTGCCGATTGCCATCACTCCCTCCTCTCGCCGTCAGGAACCTGGATTTGAAGGAGTATCGGATCGTGACA
TCAGTTTAGGACACGAGACACAAAACATTGAACAGTTTGACCGGATATACTACAAAAAAGGCAATGGTCCTCTCAATGCC
ACGGACTACGATATCATGCTGAGCAACCACGTTTGGGAGAATGCTCCTACGAGTCTGCCAATTACGCAGATTGCAGAAGA
ATCTGACCGGCGTCAACCCGAGTCGTCGCAAGCGGCCATTGAGAAGTTTGAAAAGATGTATCGTGACAATGCGTCATACA
TTTCGCGCTCTGCCACGTGGGGAACGCGGCGCCGCAGTCTCCCCAGCGTCACAGATATGGAGGGCATCACAAGCGGAAAC
TTTTTCAAGAAACTCTCCCTCAGCCGTGGCGACACGCGCCGTCCGAGCATCTTTGAGGGGCTGCGCACTCTTGTCAGGAT
GCCGAGCACAAGCCAACAGCCAAAGAGGGTTCGGACCAGCCAGGAAATTGAGAAGAAACCTACTTTGGACACGAACTGGG
GCGACTTCAGTTTTGGGGAAAGCAGGCGGGACAGTAACTCGCTTGTTCCTCCTTCTCGGACTCTGAGCACGGGCAAGAAC
AAGCAGCACATGCCTAGCATTAATACTGCTCTGGTCAATATGGGAAGCAGTGTGGCTTCTATCGGGACAACGCACGCTCG
AAATGGGTCTGTAAGCCGGCAACACACGGGTTCGGTCAGCTTGAGCCCTCCGTTGACTTCGCCCAAGAGTCCTCTTCTGA
AAGTGAGCAATTCTCTCCGACGCCAGAGAAGCAAGTCGCTGTCCAAGGCGACACCCGAAAACCCGCACCCGAATCTCGTT
CGCATGTTAAAGACCGCGGGCGGGCCACCAGTGGCAAACTTGGCTACTGGGAACTCTGCCTATGGTCCGCAGACTCCTAC
GCTCTTTTCGATGAACAGCCTTCCCCTCTATACTTCAACAAACGCACCGGTACCTGCGCCTGTTATTGCAGATCCTGACG
ACGATGATGATGATGAAGACGAAGCATTTGATGAGGGTGACGTGAAGCCCGAGTCCGATGGACTCATCAACACGATCTCA
CCAGACCTGAAAGGTTTCCGAGAGCTAGTTTTCACGCTGAACCCTACACTATCCAGTACGAATACGTACCTCGTGGATCG
GATCGCGTACCAGCAGATTCAGCGCTACAAATCTTTGCTGAATAACAAGGTGAGACATCTCAGCTATGTGAAGGGCAACA
ACTGTCCAAGTGGCGACCTGTGCATCGAACAAGGCGGTGCGTCTGTGCTGCTTGATGGCAAGATGGACGTGGTTCCTCTC
GATCCCCTATCGACTGGATATGGATCCGCAGATATCGGAGATCTCGCTTCGCCCCTGGATGGTGCTGTCAGCCCCGAAAG
TTTTCCCCAAAGCACATACCGATGCCGCCAACAAGTGTTTTGCCTGCCGAGTTCGAATGCCAGTTGTGTTTTCAGAACAA
ACGCTTCCAGAAACCCTCAGACTGGACGAAGCATGTTCACGAGGATGTGCAGCCATTCACATGCACATGGGACCGCTGCC
GGGAACCCAAGATTTTCAAGAGGAAGGCCGACTGGGTCCGCCACGAGAATGAAGGTCACCGGCACCTGGAATGGTGGACA
TGCGATGTGGATGAGTGCCGGCACACATGCTACCGCCGAGACAATTTCTTGCAGCATCTGGTCCGGGAGCACAAGTTTCC
CGAGCCCAAGCACAAGACAAAGGCGGCGATTAAGAAAGCAGGCGCCACAGACGAGACGTGGCAGCGAGTTGAGCAATGTC
ATGCGGAGACAACAGACCGGCCACAAAACGAACCGTGCAAGTTTTGTGGCAAGACGTTTCCGACGTGGAAAAAGCTCACG
GTGCATCTGGCCAAGCATATGGAGCATATCAGTTTGCCTATCCTGAAGCTGGTGGAGCGAAAAGAACTGGATGCGGATAC
TTTAATTAGCCCTGTCCAAGAACCACCGCAGCGGAACTTTGCACCAACGCCGACATTCCCAAGTGTAGACGAGACACAGC
ACAACATGATGCCCAATCCGTCGAATCTGGTGTCGATGACGCGAGTACCTCCGGGTCCATTTCACCAGACTCCGCTGGGG
CATACAATGGCGTATGTCCCGACTGGCGCTCCCGAATCGAATGATTATGTGTACCCGACTACTACGCAAACACCGTATCA
GCGGTCGTACTACGGCCAACAATCATTTGCACCGCCGATGGGTATGGCATCGCAGATGCAAAGTCTGAATGGAGCAGCAA
TAAATGTGATTCCGGTGTCTGCTCCGTATACTGGTGCTGCTTATGGACCCGGCCACCTGCCTCTTACAACGACAGGCTAC
CAAGACCCAACATCGAACCGAGTGTTTTCAAATTCGAGTATCGATGCGGTATCCTACCCTGGGTTTTCGACGGCCATCGC
TAATCCCCTGGGGCTGCAAACGAGTCTATCCAGCGGCCAGATGGACTATGAATTGGTTACCAACCCGTCGATTGGCTCTA
TCCCTCCGTATAAACGTGCACCACTGAAGGGCCAAGGGCAGTTCTACGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62