GenePrediction:GLEAN_8185 Details

Name: GLEAN_8185
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:489973..488449 (- strand)
Length: 1525
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:489973..489642 (- strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_113:489592..488676 (- strand)
Length: 917
Type: CDS
Source: GLEAN
Position: GCSC_113:488615..488449 (- strand)
Length: 167
>GLEAN_8185 class=GenePrediction position=GCSC_113:489973..488449 (- strand)
ATGAGCGAGCTGCAGCGACGGTGGGCCAAGGCCAAGATGGATGCGCTCGCGGCCGGGCGTTTTGACGAGAGGGACGAGGA
CGAGGCGGCGGACGAGGACGGGCGGACGGCCCAGCTCCAACCACAGACATCGCCGGCATCGTCGACATTGGCGTCCACGA
TGGCTAGTAATAGCAGCAGCACCAGCAGCAACAGCGGTGGAGGCACCGGCATGTACGGGTCGGACCCGGTGGACGACGAT
GCGGCGTCGCTGTCGTCGGCGTCATCGTCGGCGTCGTCAACAGGCACGGTCGTTCCATCGGCCAGCCACAACCTCTTTGC
TCGGCCACACGGGTGAGCCAGATTGGACAGTCGTCTTCTGCTCAGCACTGACGACCCTTAGTCTTCCCCGCGGACGCACG
CTGGACCCGATCCCATGGACGACCTTTTTCGAGCGCGAGCTCTTTCTGGCGGCTGACGACGGCAGCGACATCGTCTACCA
TGCGTACCTGACCTCGCCAGTCGACAAGGGCCCGCTCTTTGTGATGCACCACGGTGCCGGCTCATCCGGGCTGTCGTTTG
CGGTTGTGGGTGCCGAGATCCGCAAGCGGTTGCCATCAGCCGGCATCCTGTCGGTGGACGCGCGCGACCACGGGCTGACA
CGGATGCGACGGGAGGCCGATGAAGACGGCGGCCCGCAGCCGGACCTGGACCTCCGGCTCTGCACGCTCAGCGCCGACCT
GCTGGCCGTCATCCGGTTGGCCCAGGCCCAGATGCGCTGGCCGGCCTTGCCGCCAATCGTGCTCGTGGGCCATTCGCTGG
GCGGCGCCGTGGTGACCGATCTCGCCCATGCCGGCACCCTCGGCGCCCCCCTCCTCGGTTTTGCCGTGCTCGACGTCGTC
GAGGGCTCGGCCATGGACGCGCTGCAGAGCATGCGCACGTATCTGGCGTCGCGGCCGGCCGGTTTCCCGACGCTGCAGTC
CGGCATCGAGTGGCACATTCGCTCACGCACTATCCGCAATGCCACGTCCGCCCGCACCAGCGTGCCCGCACTGCTCGTGC
ACGACCAGGAGCCGGCCGGGGGCGAGACACCACAGACACCGCAGACGATGTCACAGCCGCCGCCGAAACTGCCTCTCTCA
CCCGAAGCCAAGCGGCGGCCGTGGCACTGGCGCACCGACTTGGCCGCCACACAGCCTTTTTGGGAAGACTGGTTCACCGG
ACTCAGCAAGAAGTTCCTTGGGTCCCGCGGCGGAAAACTCCTGCTGCTGGCCGGGACTGATCGCTTGGACACGGAGCTGA
CCATTGGGCAGATGCAGGGTGGGCAGATCTTTCTCCTCTTCTTCCTTTTCCCCATCTGCGCTAACCCGTCCATACTAGGA
AAATATGCCCTCCAAGTCTTCCCAGAAGCCGGTCATTTCATCCACGAGGACCTGCCGGAAAAGACAGCCATGACGCTGGT
CGATTTTTACCGCCGAAACGACAGGACGGCTCTGGTGCTGCCGCCAAAAGTGTCCGAGATGCTGGCACAGGGCAGGAAGG
TATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62