GenePrediction:GLEAN_8187 Details

Name: GLEAN_8187
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:474053..473639 (- strand)
Length: 415
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:474053..473763 (- strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_113:473671..473639 (- strand)
Length: 33
>GLEAN_8187 class=GenePrediction position=GCSC_113:474053..473639 (- strand)
ATGGACTTCGAGTACACTACAAGTCCGAAAATCTATACAACTCTCAATGAGCAGCTGCCACCGATTTCTTTGGTAGTTTC
AGACGGATCAACAAGACGCTGTATTGAAGAGCCTACACCCGCCTTGGATACATCGTTCAAAGCCGATGCACATCAAGATG
ATCTGAAGAAAAGCAGTGATACTCAATCTCAAGCTGATGAAGAGCTACCGGAAAATTCGGATGCTTCTCCATTGTTTGAG
GCTGAAGACTTTATGGGCGCTGGCTACGAGTACGACACCTGCTTTGGCGTCGTAAGTCACAATCATGCAGAGAGCCTGCC
CCATGTCCGAACATACTGACCTTGTTAGATTATTGAGGCCGCTACCTCTTCCTTCATGCCAGAGAGCGATTTCCGATCAT
TTCCTGTACATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62