GenePrediction:GLEAN_8188 Details

Name: GLEAN_8188
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:464138..460530 (- strand)
Length: 3609
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:464138..464034 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_113:463971..463924 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_113:462874..462788 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_113:462534..462244 (- strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_113:462149..461955 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_113:461874..461791 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_113:461032..460999 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_113:460885..460530 (- strand)
Length: 356
>GLEAN_8188 class=GenePrediction position=GCSC_113:464138..460530 (- strand)
ATGACCACCGAAATGATCACTACCTACATAGAGGCGCGTTATGTGAGCCGGAAAAAGCTACGCGAGTTGCTGGACACCCT
CTTCGGGGATGATTACAATGTCGTCGTAAGTTATTCCCTGAAACCAATATCATATATTGCAACGCTTTGATCACTTATGC
TTCCCAGATGGCGGCGGATACAATTGCGGTGGAGGCAATCAGACAGCTGACAGAGGTGAGGCAGTCCTACACAGGATAGT
GAAAGATTTTGAGGCGCTTACAGGAAAATCATGCCAGGAAGAGAAAAAATCCGTGGTGCGCAACTGACTGCCCATCTGCA
GAGGCGCAGAAAGCGCCTAACGAGGCGGGTTGAAACGGAGGTGGGGCTTGGAGTACTCTGTATGCATCTTAGAATCCGTT
TCGGAGCTCTTGGATTATGGTGCCCAACTGGACGTTATGTGTTGTTAAGTAAGAGTACTTCTGAGCCCTACGGAGTACTA
CTTCGTAAATAGACAAGGTCAACTGGCCTGTGCTCCACAATACAAGTATAAGTAAGTAGTATATATGTATTACAGAGTGC
CTGCAGCAAAACCTTGAATACATTCTGCTTAAGATGCTACGCCGTACAGCGTAAGTTAGCAGCAAGCTACAAGTGGAGAA
GCTAGGCATTATAGATCACAAGTGCTAGTGATGATGCCTATACAAGTGCCAACCGCCCCAGCTTCGGGCCTAGGGACGGG
CCTAGACCGCCTGAAGCAGGTAGCGCACCAAGTTGGCCTCGGACATCTGTGGCAGACCTTCGAGTCCAATTTGCCAAACC
TCTTTGTCCTCCAGGACGTACCCAACACAGTCGGCGTGGCCACGGTGGAAGGGGAGCCTCCGTGCTGGCTATCGTCACCG
AGATTGGTGTGCGCAGCTGTGCGCAAAGACGACTCACCATTGTTGTACGTATGTCTTTGTCATCCTCACACCTCTGCCTG
ATGGATCGATGATTAACCAGTTTGGGGACCCCTCTGTCCAGCATTCTCAGACGGCGTAGCTCGTGGGGGTCGGGATCGAC
TGTACATTCCAGACCTTTTCTGTCGTGTGTCAACTTGCCGATGCTACGCCCTTATTTCTACAATTTGTACTCGGGATGGG
TCAACGTTTCTCATCCGGTGACGAGGACTTTATGTCCTGCTACAGCTCATCCTCTCTAGGGGATACCGGTTGGTGTGAGT
CTCTCATCATATAATGATAGCTCATAGCTATCAGAGGAGCTGTCTTGCTCATAATTTTCAACAGGGATATGCTACAACGT
TCGCCACTTCGAGCGGCATCACAGAGACCTCGAGGATCCATGGTCCTGTCGCCAGTCGGCCCTACACCACAGTTTGTCTA
CAGACTCAAAACAATCAAAATGGATTGTTATACAACCTCCAGAGGCGTTTAACCTAGCTCTGGAACCAGCACCACATCCA
ATGTCCCTGCATATTCGATATCTTCATGCTGTTCTTGCTAATTGGAGAGAGTATCTAGAGTATTTTGCCCAAGAACTCAT
ACGTCTTGTTAGTATCCCATATCGTTCTCCCGTCCTCCCTCCTCAACTTCTTACTGACCTTTTCTTCTGCTCGCCGATTG
ATAGAAGCAGCAAATTACCATGCCAAATCCGATTAGCAATCTCAAGGTCGAATTCGCACATGAGCAGCATGTTCACCATC
TGAAGGGAAAGCTACACCATGCCCTGTGTATTCTCGCCAACACTGCCAGTACGCTCGTGATTATTGCCGAGCACGAACTC
TCGATAATGCACAGCCTAGGATTGACTTCCCATACCGATGACCGCTGTCTCTTGCGGAATATGTCTCGGGATGTGGATGG
ATACCAAGAGACAGCAAGGAAGCTTCTGCGCATGTTTGACGACCTGCAGTCTATGGTAGGACTTAAAACCCACTTACACT
CTTGGCTGCGGCCGTCATGAGCATGGACAAGGCTGCCTGAATCTGACCAGCCACCACCCACTTGCGCAGTATGGTAAAAT
CCTCGCCCTGCGTGGCCAGGAGCTACAACACGATGCCAGCCTCAAGCTCGCACAACTGGCACAGGCCAATGCCGCTGAGA
GCCAAAATATGGTATTGTTGGCTGACAGCACATACAAAGACTCACGGGCAATGCGTATCGCGACGGCCATTGCCATGCTT
TATCTACCCGTAAATTTGGTCATGGTAGGTAGCTATTATTATTTTCAGATTTCCTCTCCTTTTGCCTGTGTCGTCCAACT
AAAGCCCGGCTCGCCAAAAATTAGTCTTTCTTCAGCAGCACGCTTGTTGTCTGGTACGAAACGGCCACGGAGGCGGACAG
AAACTCTACAATGCGGATCCGCCGTGAGGTATGGATTGCTATCGTGGCAGCTGTCATACTTGCCATCGCTACTACCTTCT
GGGCGTGGTGCTGGGACCGAAAAGAGAAGAGAAAGAAAAGTGGAAAGATGCCTTGAACTCGAATTTTATGTCCACGAAAA
ATATGGTATAGGTCTACTGTTTTTTCCTCACGTATCCCCAGCCATTTGTGCAACGGATTTGTTGGACGGCTGAAGCACCA
GTACAATATCACTTCCAGTATTGTGGGCGTGCCGCCGATTTCTTGATGCAAGTCAGAGGAAACTAAAATTGTGCGGATTA
TTTCACTTGTATCTAACAGCAAACCGGCCTCGCCCAGCCAAGACATGCAGGAGTGAAAAGCTAACGCACAGATCCTACAT
AGTAAGCTCGCCGCTATTCTCCCATAAGCAACACGCCTAAGATGACGGGCGGTACTATGTGCAAGTGGAAGGTATTTCTC
TTTTTCTTATACAGAACAGTATGTGGTATTGCCTTCAATGTCCAGGCCTCTCTTAATTTATCGGGGATAGGCATCCTGTT
CTTCCTTCAATAAGCATAGCATGTCCCATTGTAATCTCAAGGATAACAACCTTTTGCTCAACGACTTTGAATTTGTACTT
AGTATTATGAACCAGATGGCTTCCGCACCGTTTCAGAATGCACAGCGTGCACTAAAGCACATAATTTAACAAGGATAGGG
CAACTATGAAGGATTGTGTGGCAAGAGAAAAACGTGTCAATTCGTACTCGTCGGTCGGTGAAACAGGAACCTCTCCCCAC
CGCAGTAAAGTTTCCCATCAGTATGTCAAAAACAGCCAGTCTTCCCATCAGTCTCATAGAAGCAGCCCAGGATCATCTAG
TTGTTGCAAATGCCTTATCGTTGCCATGCTATCTATTTTTCTTTCGTACGCAGGCGAGTCAACGGCTCAAATCGACACGA
CCAAACTCGGCATCGATTTGGCATCCGAGACCAGACGCACACTCCGGGAACTGGCAGCGTCTGGAGTCGACGATGAAGAC
AATAACGTAGCTGATGTCCGGTGGTGTGGTGAGGTCGGACGGGTAATGCGGATTGATTTCGACCGGGCGTATCTTCAGAG
CTGGCAGCACTCACAGACAGCCAGCATTGGCGCTCCAGAAACGCCAGCCACAGTCGATGTCCTGGATGCGATGGAAGAGA
CGGAGAAAGAAGCCAGTGCACGACCAGCAAAGCGAGCAAAATACGACAGTAACAAAGTGGCTGTCGTCGACGCAGAGCTG
TCAGGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62