GenePrediction:GLEAN_8189 Details

Name: GLEAN_8189
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:457365..455225 (- strand)
Length: 2141
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:457365..457261 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_113:457181..456863 (- strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_113:456800..455600 (- strand)
Length: 1201
Type: CDS
Source: GLEAN
Position: GCSC_113:455540..455225 (- strand)
Length: 316
>GLEAN_8189 class=GenePrediction position=GCSC_113:457365..455225 (- strand)
ATGTGTGCAGTGCTCGAAAGAGCGCCCGACGTGCAGCGGCTGCATCCGGACCCAAAGACCGTGTCACTACAGCGGAAGAG
CCGTGCGCTCGCCGTTGACCAGGGTGTGAGTACGCATCCGGCCGCCAGGAGATGGCGTGTCTAGCGTCTGCTCACCCGGC
TGCAGACATCTCTCGAGCGTGGAGGCCCGGCTGCACCGGCTGGAGCGGCTGTTTGCCCAGAAGCTGCCCAACGTGAACCT
CGAAGAAGCCCTGGAGTCGGTCGACGACGACGAGTCCGATGGCAGTCCGGCGGCGAACAGCAGCAGCCGAGCCTCGACAG
CACGCTCGCTGGCGACGCCGGCCCCGAGCGCCGAGTACGGACAGCTGCCGGACGAGCATAGCCGGTCCATCGCAGACGCC
GTTCCGGACGGTCCGGACGGCTTCGACTGGCAAGAGGACGTCAACGTGCTTGCCGATGGCATGGCCGCGCTCTCGGTCGA
GCCAAAGGGCACGGGCTACCTGGGTGAGTCGAATGGGTCGCTTGGGTCGCGTGCCGTGATCAGCTACTAACAACAGTGCT
GCCAGGATCCACGGCCGGGGTCTTCTTTCTTCGCTCTCTGCTCTTCTGGATGGGCGAGTCCAAGGCCACGTTTGACACAC
ACGTCGAGCTCGCCGGCCTGCTGTCACCTCGGTTTCTTCCATCATCCAGTCTGCTGTCTGGACCTTCGGCCCAGCTCGGC
CATGCGCAGCTCTCGCGCGACGTCCTCGGCCGACTCATGGACGCATACTTTGGCGTCTACCACCAGACATACCCGTTCGT
GCACGAGGCCACCTTCCGGGCTCAATGGCACGAAGTCATCCCGCGGCCGCAGAAACGCAGCTGGCAGATGCTCCTCTACT
CTGTCCTCGCCATCGGCGCCTGGTGTCTGAACGAAGACCAGGGCGAGCTCGAGGACGAGCTCTACCACCACGCGCTCGCC
TTTGGCGAGGACGAGTCCATGTTTGAGAGCGCCAACCTCACCTTTGTCCAGGCCCTCGTGCTGCTCAGCAACCTGTCACA
GAAGCGGGATAAGCCCAACACCGGCTCCAACTTCCTCGGCCTGGCCGTGCGCATGGCCCTCAGCCTCGGGCTACATCGCG
AGCTCCCCGACTGGGACATCAACATGCTGCAGCGAGAAATGCGACGACGCGTCTGGTGGGGCCTCTTCATCTTTGACAGC
GGCGCTTCTACCACTTTTGGCAGGCCTATCCTGCTGCCCGGCCCCGAGGCCATGGATGCCCGCCCGGTGCTGAACGTCTC
GGACGAGCTTCTCACTGCCAGGACGGCCGAACTCCCGCCTGGGTCCTCGAGCCCGACCGTCTATGCCGGCCTCAAGGCCC
AGAGCGACTTCCACCTCACGTCGAACCATATCTCCAACGCGCTCCTGTCGGCCTCAGGCATCGCCCTGCAGGACGCCTTG
GCCATGAACCAGTCTCTCGACGGCTGGTCCGACACGCTGCCGTCCTACTTCTCTTTGGCTGAGCCACCGGAATCCAGCGA
CGATTGGTACGTCTTCGCACGGTCGCGGCTCTGGTGGCGCTTCTGGAACCTCAAGATCATCCTCTTCCGCCATCTTCTAT
TGAGGCGGGCCGTCGACAGAAACCGCAGCCCGCCCAGCACAACCTCCAACCCGCTCGACGAGCAGGCAATACAAGTCGCC
ATCGATGCGGCCCAGGCCACAATCTCTTCCATCGACAACTACCTCCAGAATCCCAGTGCAACCCGGCTTGCCGCCTGGTA
TTCTATGTATGTACATTCCACCACTACACAACTGCAGTCATTCAAACCCGGCTAACACCAGCTAGATTCTTCTTGTTCCA
TGCGTCGCTTGTTGTCGTCCTTGCCATTCTTGGCGACCTGGAGTCCCCAAATATGGCCGCCTGGCAGTCAAGCATGGACA
CCGTCCGTAAAATCCTCAGGCACATTCTTGGCCGACACCAATTGGCCACGAGATGTGCTGATATTCTTGACCATATCCTC
CCCCCCGGTACCGAAAATTTGGGACCTTTATGGGGAGGGGAAAATATGGACGTAGCTGCTATCGACTTCTCTATGTGGCC
AGCCGATGCAGGAGACATGTGGGGAGCGTTTGTGTGGCCGCAGCCTGGAGAAGGATTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62