GenePrediction:GLEAN_818 Details

Name: GLEAN_818
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:223137..225004 (+ strand)
Length: 1868
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:223137..223284 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_132:223334..223411 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_132:223464..224729 (+ strand)
Length: 1266
Type: CDS
Source: GLEAN
Position: GCSC_132:224784..225004 (+ strand)
Length: 221
>GLEAN_818 class=GenePrediction position=GCSC_132:223137..225004 (+ strand)
ATGGCCTTTTCCACCGCCGGCCTTCGGAGGCGTGCAAACGGTTTGAAGGAGCGCCTGAGGCTCCATGGTGACGACTCCCA
GCACGAACAAACAGATGCATGGAGCAACCGCGATCTGATCCCTCTGCCTCCTCAGCGTCGCATCTGGGGTACGTTGCCCT
GTCATCTGCACCTGAGTCTGCCCTGCTAACAGACCAGGATGGTTTCACTTCTTTGGGTACTGGACCCTGTCGTCCCTCAA
CATTTCCAATTGGCAGACTCCCAACACGTTTCTCGGTAAATTGCTTCCATCCGTTCGTGCTCTTGCACGCCGCTAACACA
CTCTCAGCCGAGGGCCTCTCCATCCGCCAGGCCATGGCCATCATCACCATCGGCCGTGTCCTCATCCTCCTCTTCTCCAC
CCTCATTGCCTGGTGTGGCATGGACTGGCACGTCGGCTTCACCATTCAGAATCGCTTCTCCTGGGGCCTCCGCGCCAGCT
ACATTCCCCTGCTCCAGCGCATCCTGCTCAACTTTATTTGGAACGCGGTCCAATGCTGGAATGGCGGCCGGCTGGCGGCC
GTCTGCATCACCGCCATCTGGCCCTCGTTTGCCAAGATGCACAACTTTCTGCCCACCAGCATCCCAGCCACGGCCTACCA
GTTCGTCGGCTTCATCGTCTTCTGGACCCTCTCCACCCCCTTTTTGGCCATCCGCCCCGAAAAGTTCAAGCTCCCGTTCA
TGATCACGTCCATCTACTGCGGCGTCGGCATGCTCTGCATGATGATCTGGGCCCTCGCCGAGGCTAACGGCGTCGGTCCG
CTGTGGCACACCGGCGAGCAGATCCCCTCCACTACCAGGTTCAGTGCCTCCTGGCTCATCGTCGGCGGCCTCAATCAGAT
GATTGGCGGCATCGCTGCCGGCATCACCAACGGCTCTGACTTCTCCCGCTACGCCCGCGGCTGGCAGCACTACGTCGCTG
GCACCACCCTGTCCGCTCTCATCGTCGGTGTCATGGTCTCGCTCGTCGGCCTCGTCACCACCAGCGCTGCCCAGAAGATC
TACGGCAGCGTCTACTGGAACCCCCCTGACCTCCTCATGGTCATGATGGACCAGGGCGATGGCTCCAGCCGCTCCCGTGC
CGGCGTCTTCTTCCTCGCTTTCGGCTTCATGCTGACTGCCATGTTTGAGAATATCTGCGGAAACTCCGTCGCCGGTGGCA
TCGATCTCGCCGGACTTTTCCCCCGCTATATCAACATCCGCCGCGGTGCCATCCTCACTTTTGTCGCCGCCTGGGTCGTC
CAGCCGTGGCAGCTGGTCAATAAGGCCGCCACCTTTGTCAGCGTCCTCAGCTCCTTCTCAGTCTTCCTCTGCCCTATCAT
GGGCATCATGACTACCGACTACTTCATCCTGCGCCACCGCAAAATCAAGCTCTCTCATCTCTACCACCCCGAGACCTCTG
ATTACTGGTACTGGCATGGCGTCAACTGGCGTGCCATTCCCGCCTGGCTTTGTGGCTGGGCCCCGACTGTTGGCGGCCTC
GCCTACAAGGCCAGCGGCAGGACTGATGGCGCCAAGGCCCTGTACCAGCTCTACTACATGGCCTTCCTGATCGGTAAGTA
TGCTGACTAATCATTTCCCCCATTTCTTCCCGTCTAACATCACCCAGGCTTCTTTACGAGTGCCATCATCTTCTATGCTC
TCAACAAGCTCTTCCCCGTTCTCGGAATGGGCGAATATGACGAGATGGACGTTTATGACACTTTCACAGCTGCGGAGGCA
GCGAAGCGCGGCATTGTTCCGGCTGACAATCAATTACAAGGCACTACGCCGTATGACGTGGCGAAAAGCGACAAGAAGGC
GCCCTATGTGAAGGAGTACTCTATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62