GenePrediction:GLEAN_8191 Details

Name: GLEAN_8191
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:447686..447100 (- strand)
Length: 587
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:447686..447684 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_113:447624..447501 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_113:447440..447100 (- strand)
Length: 341
>GLEAN_8191 class=GenePrediction position=GCSC_113:447686..447100 (- strand)
ATGGTATGCACGGCGAGATGAAACATCATGACCGGATACACGACTGCTGACCGATGCTGCAGGCTACCCGAGAGACGGCC
GATCTGGGCGAGGCCCATTTGCCCAAGCACGAGTCCATCAAGGCGTTTGGCGAGATTGAGCACGAGCTCCGGAAGCAGCT
CGTGCATCTGCGCCACGACCACGACAGTACGTGGGAGAGGGGTACGCGTACAAGTATAGGCGCCAACATCTGCTGATAGT
GACCAGAACATCAGCCAGAGAGCTTTGCTGCCGCATCCGGCCTGTCGGATCACGAGCTGGCCTCGTTCACGTCTCACGAT
TTGGTGCTCGTCCGCGTCGCCTCTACGGCCTACGGCATCATCCTGTTTGGCAAGCTGCGCATCCCAGCGCTCGTGGCGGC
GGCCGGCGGCGACGAAGCCGCGCCGGCCTACGTGCACTTCCGCGCCTTTGACGAGGGACCAAATTCGAAGGCCTGCTTCC
ACAGCTTCTACACGCGCGAGATTGACACGCCCACCGACGAAGGCGACGGCCACCTGCACACGTACCAGACCCTCCTCCCG
GCGACCGAAGCACTCGAGTGGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62