GenePrediction:GLEAN_8192 Details

Name: GLEAN_8192
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:442527..440808 (- strand)
Length: 1720
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:442527..442426 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_113:442357..442264 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_113:442206..441992 (- strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_113:441935..441806 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_113:441754..440808 (- strand)
Length: 947
>GLEAN_8192 class=GenePrediction position=GCSC_113:442527..440808 (- strand)
ATGGCTCCTGGATGGCGCCCCCGGCTGGTTCTCAGGCCGGCATTGCCTAGAGTAGCTTTGGCGTCGTCCAACGGCCGGAT
TGGACAACGGGCTGGCATTTCGGTATGCTGACATTGAGACCCTTTCTCTGAAAGTATGCCGTCGGCTCTTGGCTGATACT
CTTCACCCAGGGCAGACAGCTTCACGTGGACCACCGGAACAGGCTGACGCAGTTCTGGGTGCCGCCTCCACAGGTGGCCC
TCAAAGACGCAAAGCAAAACGAGGGTAAGCCAAGCTGAGGTTCAGGAAGATATGTCTGCTACTGACGGTTCACTGTCGCA
GAGTCACACGCCAAGCTGGTACGCGCGGGATTCTTCCGCCAGGCGCACTCGGGCGTGTTCCACATGCTGCCGCTAGGCCT
CCGGGTGCAGGACAAGATTGAGGCGCTGGTGGACAAGCACATGCGGTCCATCGGGGCGTCGCGCGTGGCGCTGTCGAGCA
TCACATCGGCCGGCCTATGGGAGCGCAGCGGCCGGCTCGGGAGCGTGAAGCCAGAGGTGAGCTGGTGGCGAGCCTTGTGC
GAAGAGGATCCGGTTGGCTGACCTCTTCGCAGCTGTTCCAGTTCGAGGACCGCAAGCAGGCCAAGTTCCTGCTGGCGCCC
ACGCACGAGGAGGAGATCACGGAGCTGGTGGCGCAGAGCGTGCACTCATACCGCGACCTGCCGCTGCGGCTCTACCAGAT
CAGTGCGTGCTTCGTGGAATGAGAATCTCTCCGTGTGCTGACTAATCATACAGCCCGCAAGTACCGCGACGAGATGCGGC
CGCGCTACGGTATCCTGCGGTCGCGCGAGTTTATCATGAAGGACCTGTACACGTTCGACACGACGGTGGAGGCTGCCCTG
GCGACGTACGAGCAGGTGCGCGCCGCCTATGCGGCCATCTTTGCCGAGCTCCGCGTGCCGGTGCGTGTGGCTCGTGCGAG
CTCTGGCGACATGGGCGGCGACCTCAGCCACGAGTACCACCTGGCCGCATCGCTGGGCGAGGACGACGTAGCCAGCTGTC
GTGCCTGTGGCTTTGCCGGCAACACGGAGATCACACACATCGGCCCCGACAGTCGGCCTGCTCGCTCCGGCGACGACTGT
CCGGACTGTGGTGCTGCCGGCTCGCTGCAGGTCGAGCGCGCCATCGAGCTCGGCCACACCTTTTATCTCGGCACCCGGTA
CTCGGAGCCGCTCAACGTGCGCGTCCAGGGCGACCAGAACACTCCCGCCACGTCCACCATTACCCCCCTTATGGGCTGCT
ACGGCATCGGCATCTCGCGTATCCTTGGTGCCGTGGCCGACCATCTGGCTGACCCGACCGGCCTGCGCTGGCCGCGCGCC
ATTGCGCCGTTTGAGGTTGCCGTCGTCGCCGCTGGTGGCAGTCCTCTCGCTCAGGTCGCCGAGCGCGTATACGATGAGCT
GACTGCAAATACCGAGACTCGCCTCGACGCCCTCCTCGATGACCGCCCCGCTGCCTCGCTACCCTACAAGCTCAAGGACG
CCGACCTGACCGGCTATCCGGTCGTCGTCATTGTCGGCGCTGCCTGGCGACGCAGCACTGCCACCGCTACCGACTCATCT
GCTCCCAACATTTCCCTCGATGGCCTCTGTGAGGTCCAGTGCCGCCAGCTCGGCCTCCGCCAGGACGTGCCGCTCAGCGA
ACTCAAGACCTTTGTGTCCGGCCTGCTGGCCCAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62