GenePrediction:GLEAN_8194 Details

Name: GLEAN_8194
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:430450..428761 (- strand)
Length: 1690
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:430450..430272 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_113:430218..430164 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_113:430098..430017 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_113:429946..429862 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:429804..428921 (- strand)
Length: 884
Type: CDS
Source: GLEAN
Position: GCSC_113:428873..428761 (- strand)
Length: 113
>GLEAN_8194 class=GenePrediction position=GCSC_113:430450..428761 (- strand)
ATGTCCATCGCGTTTAATGTCGAGCAGGCCATCGTGGCATGCACGCCGTCTCGGGTGAAGACCGCCGGCGACGAGAAGCA
AGTGCTGCACAGCCGGCTCTCAGCCGACCATGAACCAGCCTCAACAGACGACGCCTCGGATGCGCCTGCAGAGGAGTTCC
AAGAGGGCGGCTATGGCTGGTAAGTTTGGTGTATTTGGCTCTCTTTGCTCTCCGTCTAACCTCGGCCGCTAGGGTCGTCG
TGCTTGCCGTCTTCCTGCTCAATGCCCACACTTGGGGCATGAACTCGGTCAGTGAGCCGGCTGCTGTCCTCGGCCTTGCT
GCATCTCCTCTGACTCTTTCTCTCGTCCCCAGTCCTATGCTGTCTTCCTGGCCTATTACCTCCGCACGGACGCCATTGGC
GGTGCCAGTGCCATTGCGTTTGCCTTTATTGGCGGTCTGTCCATTTCAGTTGGTGAGATGTCCCGTCGTCTGTCGTTTGT
CGTCTGCTCGTCGCTGACTGGCAGCCTTTCTCGTGTCGCCTTTTGCCAACATCTGCATCCGTCGTCGCGGCACACGCACT
GCTCTTTTGACTGGTGTTTTCTTTGAGACGTGAGTGTGTGTGGTCTGGCCTGCCGTCTCTCCTGTCGTCTCCCTCTGACC
GTTTAGTGTCGCTTTCGTCGGCGCCTCCTTCACCAAGCAGATGTGGCAGCTGCTGCTGGCCCAGGGTGTTGCCTTTGGCC
TCGGCATGGGCTTCATCTTTGTGGCCAGCGTCGGCGTCGTGCCGCAGTGGTTCGTGCGGCGCCGGTCGTTTGCCAACTCG
CTGGCGACGGCTGGCAGTGGCTTTGGCGGCCTGACGTACTCGCTCGCGACCAACGCCATGATCCGCCACATGGGCCTGGC
CTGGGCCTTCCGCACCATCGCCATCGTGTCGTGCGTGGTCAACCTCGCGTCGACGATGATGGTGCGCGACCGCAACAGAT
CGGTCGGTGCCGTGCACGCTGCCTTTGACCGCACCCTCTTCCGCCGCCCCGAGTACTATCTGCTGATGAGCTGGGGCTTC
TTCTCGCTGCTCAGCTACACCATCATCGTCTTCTCGCTGCCCGACTATGCCGAAACGGTCGGCGGGACGGCCTCGCAGGG
CTCTCTCGTCGGCGCCCTCTTCAACCTGTCGCAGGGAATCGGCCGGCCGCTCATTGGACTTGCCAGCGACCGCGTTGGCC
GCATCAATGTCGCCGGTCTCGGCACTCTTGTCGCCGGTCTCGCCGCCCTGTTCGTCTGGAATTTTGCCGGTCGCTACTAC
GGCGGTCTCGTCGTCTATAGCCTCCTTGGCGGCTTCGCCGGCATCCTCTGGGCCACCGTCGCGCCCGTTACCGCTGAGGT
TGTCGGCATCGCCCTGCTGCCTTCGGCCTTGTCCGTCTTCTGGGTCGTGCTCGCCTTTCCTGCCACCTTTGCTGAGGTCA
TCGGCCTCAGCCTGCGCACCGCCGGCGTCGGCGCATACCTGCATGTGCAGCTGTTCACCGGCCTATGTTACATTGCCGCC
TTTCTGTCGAGTACGTCGCCCTCCTCCACTTGTGGATTCCCTGCTGACCGCCCCCAGTGTGGCTGCTCCGCGCCTGGAAG
CTCCACCAGATGGACGACTCCCGCCAGACGACGCCGTTTGTGTCTTTTCTGCTCAAGGGGAAATGGGCTTTTGTGGTGGA
GCGGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62