GenePrediction:GLEAN_8195 Details

Name: GLEAN_8195
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:424504..421784 (- strand)
Length: 2721
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:424504..424406 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_113:424300..421784 (- strand)
Length: 2517
>GLEAN_8195 class=GenePrediction position=GCSC_113:424504..421784 (- strand)
ATGGCCGTCCTCGGCGATGATTTGTTGACGACCGTCAACAAGTTGCAAGACCTCGTTTTTAATACCATTGGCAACGATTC
GCTCGATCTGCCCCAAATAGTGCGCCGCCCCACCTGTCTCCCTGTTTTTCTGCACTCTCTCTCCTCTCTCTCTCCCTGTC
CCGTCCCCTTCGACATGCCCCGCTAACACTCCGCTGCTGATTAGGTCGTCGTCGGCTCGCAATCGGCGGGCAAGTCGTCC
GTGCTCGAAAACATTGTCGGCCGGGACTTCCTGCCCCGCGGCAGCGGGATCGTGACAAGGCGGCCTCTCATTCTGCAGCT
GATCAACGTGCCGGAGGAAGAGGGCGCCAATGGGGCGGCCGCCATCAACGACAACCGGATTCAGTTTCTCGACCCCAATG
CGGCGCGGCGGTCGGAATGGGCTGAGTTCCACCACCTGCCGAACCGGCGCTTTATCGACTTTACGGAGGTGCGGCGCGAG
ATCGAGAACGAGACAGCACGCGTGGCCGGCACCAACAAGGGCATCACGCGGCAACCCATCAACCTCAAGATTTACTCGCC
ACACGTGCTCAACCTGACGCTGGTCGATCTGCCGGGCCTGACAAAGGTGCCGATTGGCGACCAGCCGACCGACATTGAGA
AGCAGACGCGCAACCTCATCTCCGAGTACATTGCCAAGCCCAACAGCATCGTGCTGGCGGTGTCGCCGGCGAACGTGGAC
ATTGTCAACTCGGAAGCGCTCAAGCTGGCACGCCATGTCGACCCGCTGGGCCGGCGGACAATCGGAGTGTTGACCAAGAT
CGACCTGATGGACCACGGCACCAATGCGCTGGACATTCTGAGCGGACGGGTGTACCCGCTGAAGCTGGGGTGGATCGGCG
TGGTGAATCGGTCGCAGCAGGACATTATGGGCAGCAAGCCGATGGATGAGGCGCTCAAGTCGGAGGTAGAGTTCTTCCGG
CATCATCCAGCATACCGCAACATCTCGGCGCGGTGCGGAACACCATACCTAGCCAAGACGCTCAACTCGACGCTCATGAC
GCACATTCGCGATCGGCTGCCGGACATCAAGGCGCGGCTGAACACGCTGATGGGGCAGACGCAGCAGGAGCTGGCAAGCT
ACGGCGACATGCACTTTAGCGGCAAGGAGCACCGCGGATCGCTGATCTTGCAGCTGATGACGCGATTTGCGACGTCGTTT
ATCTCGTCCATCGATGGCACGTCGACGGAGATCTCGACCAAGGAGCTGTGCGGCGGCGCGCGCATCTATTACATTTTTAA
CTCAGTCTTTGGCAGCGCGCTAGAGTCGATCGACCCGACGTCGAATCTGTCGGCGCTAGACATCCGCACGGCGATCCGCA
ACTCGACAGGCCCGAGGCCGAGCCTTTTTGTGCCGGAGATGGCCTTTGACCTGCTGGTGAAGCCGCAGATCAAGCTGCTG
GAGATTCCGAGCCAGCGCTGCGTGGAGCTGGTGTACGAGGAGCTCATCAAGATCTGCCACACGTGCGGTTCGACAGAATT
GAGCCGGTTCCCACGGCTGCAAGCGAAGCTGATCGAGGTGGTGTCAGACCTGCTGCGGGAGCGGTTGGGCCCGGCGTCCA
ACTATGTCGAGTCGCTGATCTCGATCCAGCGGGCGTACATCAACACGAACCACCCCAACTTCTTGGGTGCGGCGGCGGCG
ATGAGCCACGTGGTCAACGAGAAGCAGGAGCGTGAGCGGCGCCGGCTGATCCAGGAGGAACGCGAGCGTCGCGACCGGAG
GCGAGCCAAGGAGCTGGGGGGTGCCAGCGTGGCCGGCAGCAACACACACGGCTACCACGGGACCGAGACGCCAGATGACG
ACGAGGACAGCGTCAGCAATGCAGGCGGTGGTGGTGGCGGCGGCTCCGTCATGGCGGCGGCATCGGCGTCACTGCGCAAG
GGCGGGCCTGCAGCGGCAGCCATGGCGGCGGCTTCTCGCAACGGCCGCAGTGCATCGCTGGCACGTGACCACAACGGCGG
CATTGCGGCGGCTCTCAACGGCGGCAGTGTGCGCGGCCAGTCGCCGTCGCGCTACGCCAACCCGCAGGCTCTCGGCAGCA
CCAAGGACTCGTTCCTCAACTACTTCTTCGGCAAGGAAGGTGGTGCCACCCACATGCTGCCGCCATCGTCGTCGGGCATC
AACGGCAACAGCGGCGCCAACAGCTCGTCGCTGGCGCCGCCGGCATCGGCGCTCGGGGCCAACATTGGACGTCACGTGAG
CCAGGCTTCGGAGCCGTCGTTTAGTCAGAGCATGCGGAGGCCCGACGACCAGCGGCCACTGCGGTCACCGCTAGCACCAC
CATCCGCCATGGACGACTACGGCACTGCCGGCAGTGTCGCCGGTAGCGTGGTGACAGCCGGTGGTGGTGGCGGTAGCAGC
AGCAACGATTTTTTCGGCGGCGAGCCGGCGCTGACCGACCGCGAGGCCATGGAAACAGAGCTCATCCGTGCGCTCATCTC
ATCCTACTTTAACATTGTACGCGAATCCATCGGCGACCAGGTGCCCAAGGCCATCATGCATCTGCTGGTCAACCACTGCA
AAGATGTGGTGCAAAATCGACTCGTCAGCGAGCTCTACAAGGAGACCCTCTTCCAGGAACTGCTCTACGAAGACGACGGC
GTCAAGAAGGAACGCGAAAAGTGTGAACAGCTGCTCGAGACCTACAAGGAGGCCGCCAAGATCATCGGCGAGGTCGTCTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62